[kmcarr]

Victor,

Run GERALD including the following line in the GERALD configuration file:

QF_PARAMS '(1==1)'

This is a conditional which is true 100% of the time; in other words, GERALD passes every read.

(This technique comes from the Pipeline User Guide)

[ShaunMahony]

As said below (and also in the Solexa documentation), Solexa quality scores in their Fastq-like format are given by 10*log_10(P/(1-P)). I thought it might be useful for some people if I posted a lookup table based on this. Note I'm giving the probability that a base is erroneous, rounded to four decimal places. Please post a reply if you think this table is an incorrect translation:

Char ASCII Char-64 P(error)
; 59 -5 0.7597
< 60 -4 0.7153
= 61 -3 0.6661
> 62 -2 0.6131
? 63 -1 0.5573
@ 64 0 0.5000
A 65 1 0.4427
B 66 2 0.3869
C 67 3 0.3339
D 68 4 0.2847
E 69 5 0.2403
F 70 6 0.2008
G 71 7 0.1663
H 72 8 0.1368
I 73 9 0.1118
J 74 10 0.0909
K 75 11 0.0736
L 76 12 0.0594
M 77 13 0.0477
N 78 14 0.0383
O 79 15 0.0307
P 80 16 0.0245
Q 81 17 0.0196
R 82 18 0.0156
S 83 19 0.0124
T 84 20 0.0099
U 85 21 0.0079
V 86 22 0.0063
W 87 23 0.0050
X 88 24 0.0040
Y 89 25 0.0032
Z 90 26 0.0025
[ 91 27 0.0020
\ 92 28 0.0016
] 93 29 0.0013
^ 94 30 0.0010
_ 95 31 0.0008
` 96 32 0.0006
a 97 33 0.0005
b 98 34 0.0004
c 99 35 0.0003
d 100 36 0.0003
e 101 37 0.0002
f 102 38 0.0002
g 103 39 0.0001
h 104 40 0.0001

[vruotti]

More on Quality

Hello,
We are looking a little closer at the quality of one of our runs. Interestingly, we see a pattern in most of our runs right at the 30th cycle. The information from the graph below comes from the s_N_export.txt files. Please ignore the graph from lane 4. This was a failed lane. The others however, including our control (lane 8) show this pattern.

This was an IPAR run with the upgraded GAII and was one of our best runs. Other runs also show this pattern at the 30th cycle. Does anyone know the reason why the qualities drop so much after the 30th cycle? Have you seem this before in any of your runs?

Thanks in advance.
Victor

[TylerBackman]

Does anyone know the reason why the qualities drop so much after the 30th cycle?

This is most likely because the qualities you are looking at are alignment normalized, and a large number of your sequences failed to align to the reference genome (due to a ligated adapter, etc.)

Take a look at the un-normalized scores (s_<lane>_qraw.txt) instead, I think you'll find that the curve is more continuous between cycles.

[baohua100]

fastq file:
@I326_2_FC306FCAAXX:8:1:50:985
ATGTCCGAAGGGCAGTCTCAAGTGGTAAAATGGAT
+I326_2_FC306FCAAXX:8:1:50:985
hhhWhhhchhhhhahShh\PO]LgXZXPNLUTZNO


MAQ alignment output:

I326_2_FC306FCAAXX:8:1:50:985 1 1 + 0 0 99 99 99 0 0 1 0 35 ATGTCCGAAGGGCAGTCTCAAGTGGTAAAATGGAT ```W```````````S``\PO]L`XZXPNLUTZNO

what's the meaning of ```W```````````S``\PO]L`XZXPNLUTZNO ?

not the same as hhhWhhhchhhhhahShh\PO]LgXZXPNLUTZNO

[baohua100]

Now we get new solexa data:

@7_1wo1J99L221/1
GGAGTTGGGGTTCAGATGAAGNAGAGAAAGACCGTAGAAGTTCA
+
UUUUUUUUUUUUUUUQUUUUUEQUQUMMUUPUUUPMPMPPJPPP
@7_Xwo1J99L221/1
GTGTGAAGGTAACCGTAATGTNTGTTGACAAACGCCGTAACGAT
+
UUUQUORRURUUUUUUUUUUUEUUUUUQUUUNNEUPPPPPPPGP
@3_avo1J99L221/1
CAGGGATGGGATATAGTTTGCNTCGGTTTTAATAGTTGGGGGAG
+
UOUUSUUUUUUUUUUURUUUUEUUUUUUUUUUOUUPPPPPPPPP
@7_vuo1J99L221/1
GATGATGATGATGATGAGCTTNTCACTCGACGGTCACAGGCTTT
+
UUUUMUUUUUQUUUUUUUUUUEUUUUUUURUUUPUPPPPPPPMP


the most of char is U , how about this quality score mean ?

[bioinfosm]

Z is better and higher score than U..
More infor here - http://maq.sourceforge.net/fastq.shtml

[BAJ]

conversion table for solexa and Phred

I found this table useful it contains both scores for solexa and phred...

http://www.genographia.org/portal/topics/reports/qualitysheet.pdf/at_download/file

It is in PDF fromat...

[seq_GA]

How to compare eland and maq quality score?
How to read maq quality score?
Thanks.