Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • nutterson
    Junior Member
    • Feb 2016
    • 5

    p5/p7 flow cell bound oligo question

    i had a question regarding p5/p7 oligos bound to flow cell and wanted to know which of the following was correct in terms of what is actually bound to the flow cell

    1) p5 oligo , p7 oligo (sense or antisense only)
    2) p5 oligo, p5 oligo complement, p7 oligo, p7 oligo complement

    if scenario 1 is correct, then 1/2 of the libraries do NOT bind to p5 flow cell bound oligo since it'd be in the wrong sense. but then do the other 1/2 (that don't bind to p5) bind to p7 making it so that all library sequences are bound?
  • misterc
    Member
    • Jan 2016
    • 46

    #2
    Scenario 1 is correct. Each single strand of DNA has the P7 and P5 oligos attached. They both need to be there for bridge amplification. After bridge amplification, all the reverse strands (attached on their P5 side) are washed off by cleaving of the P5 oligo on the flow cell surface. This leaves all the forward strands in tact for read 1. Read 2 reads the complementary strand, which will be bound on the P5 oligo side (having their P7 oligo sides clipped).

    Comment

    • nutterson
      Junior Member
      • Feb 2016
      • 5

      #3
      thanks for the response.

      let's say we have 2 ssDNA as follows:

      p5 - insert - p7

      complement p5 - complement insert - complement p7

      if this is introduced to the flow cell, only 1 of these strands will actually bind flow cell oligo right (either p5 or p7)? meaning 1/2 the template does not bind. however, the non-binding template is necessary pre-sequencing to generate enough template via pcr. is this correct?

      Comment

      • misterc
        Member
        • Jan 2016
        • 46

        #4
        No, all the ssDNA binds to the flow cell surface (in a perfect world anyhow). The complementary strands from the original dsDNA have the P5 and P7 oligos on opposite sides from one another.

        5' - P5 - insert - P7 - 3'
        3' - P7 - insert complement - P5 - 5'

        Comment

        • nutterson
          Junior Member
          • Feb 2016
          • 5

          #5
          once the adapters are ligated, wouldn't you (at some point during the following pcr steps) generate strands that are complementary to p5 and p7?

          Comment

          • nucacidhunter
            Jafar Jabbari
            • Jan 2013
            • 1250

            #6
            Originally posted by nutterson View Post
            i had a question regarding p5/p7 oligos bound to flow cell and wanted to know which of the following was correct in terms of what is actually bound to the flow cell

            1) p5 oligo , p7 oligo (sense or antisense only)
            2) p5 oligo, p5 oligo complement, p7 oligo, p7 oligo complement

            if scenario 1 is correct, then 1/2 of the libraries do NOT bind to p5 flow cell bound oligo since it'd be in the wrong sense. but then do the other 1/2 (that don't bind to p5) bind to p7 making it so that all library sequences are bound?
            Details of flow cell oligos and some adapter sequences are in the following doc. Please note some portions may be obsolete but should give answer to your question.
            Attached Files

            Comment

            • kmcarr
              Senior Member
              • May 2008
              • 1181

              #7
              Originally posted by misterc View Post
              No, all the ssDNA binds to the flow cell surface (in a perfect world anyhow). The complementary strands from the original dsDNA have the P5 and P7 oligos on opposite sides from one another.

              5' - P5 - insert - P7 - 3'
              3' - P7 - insert complement - P5 - 5'
              No, that is not correct. In the finished, dsDNA library molecules p5 is base paired with the reverse complement of p5 (p5rc) and p7 with the reverse complement of p7. p5 and p7 are not reverse complements of each other. You may be confusing the fact that TruSeq ligates partially non-complementary ('Y') adapters to the dsDNA fragments which do have p5 & p7 at the same, non base paired ends. After PCR enrichment one end of the fragment has p5 and the other p7. Here is a figure showing the initial Y adapters and how enrichment PCR converts those to fully dsDNA library molecules with p7 at one end and p5 at the other.
              Attached Files

              Comment

              • nutterson
                Junior Member
                • Feb 2016
                • 5

                #8
                Thank you both. The attached pdf was exactly what I was looking for!

                So at the end, the dsDNA can have either p5, p5rc, p7, p7rc attached. Does the flow cell contain seq for p5, p5rc, p7, p7rc as well or only p5, p7 or p5rc, p7rc?

                Comment

                • kmcarr
                  Senior Member
                  • May 2008
                  • 1181

                  #9
                  Originally posted by nutterson View Post
                  Thank you both. The attached pdf was exactly what I was looking for!

                  So at the end, the dsDNA can have either p5, p5rc, p7, p7rc attached.
                  It's not really correct to say that the dsDNA "can have either". Every dsDNA library molecule has the one p7 end and one p5 end. Since it is dsDNA these ends will naturally have both the forward and reverse complement of the oligo sequence.

                  Does the flow cell contain seq for p5, p5rc, p7, p7rc as well or only p5, p7 or p5rc, p7rc?
                  The flow cell has only the forward p5 and p7 oligos. Remember that these oligos serve as the primers for bridge amplification so they must be present in the correct 5'->3' orientation; the 5' ends are anchored to the flow cell and the 3' ends are free and extension proceeds from that end during bridge PCR.

                  Comment

                  • nutterson
                    Junior Member
                    • Feb 2016
                    • 5

                    #10
                    Gotcha, thank you so much.

                    Comment

                    • hyssakura
                      Junior Member
                      • Mar 2012
                      • 3

                      #11
                      Originally posted by kmcarr View Post
                      It's not really correct to say that the dsDNA "can have either". Every dsDNA library molecule has the one p7 end and one p5 end. Since it is dsDNA these ends will naturally have both the forward and reverse complement of the oligo sequence.



                      The flow cell has only the forward p5 and p7 oligos. Remember that these oligos serve as the primers for bridge amplification so they must be present in the correct 5'->3' orientation; the 5' ends are anchored to the flow cell and the 3' ends are free and extension proceeds from that end during bridge PCR.
                      The both of complement ssDNA can hybirdize to p5 and p7 oligos on flow cell. But in the skematic of Illumina, only p7 oligos can extand to be the initial template before bridge PCR. So Why p5 can't extand?

                      Comment

                      • emham
                        Junior Member
                        • Apr 2019
                        • 6

                        #12
                        Originally posted by kmcarr View Post
                        It's not really correct to say that the dsDNA "can have either". Every dsDNA library molecule has the one p7 end and one p5 end. Since it is dsDNA these ends will naturally have both the forward and reverse complement of the oligo sequence.



                        The flow cell has only the forward p5 and p7 oligos. Remember that these oligos serve as the primers for bridge amplification so they must be present in the correct 5'->3' orientation; the 5' ends are anchored to the flow cell and the 3' ends are free and extension proceeds from that end during bridge PCR.
                        Hoping to revive this thread just to double check that I know exactly what’s happening. If I understand the oligos that are on the flowcell correctly, they are forward p5 (AATGATACGGCGACCACCGA) and forward p7 (CAAGCAGAAGACGGCATACGA).

                        Any given ssDNA molecule after denaturation will either have P5 and P7rc OR P7 and P5rc.

                        Therefore, the molecules with P5rc or P7rc at their 3’ ends will hyb to the flow cell lawn and the flow cell oligos will be extended.

                        Right?

                        Comment

                        • darklight
                          Junior Member
                          • Sep 2021
                          • 3

                          #13
                          New member here. May I ask why I cannot view any of the attachments in the thread?

                          Comment

                          • luc
                            Senior Member
                            • Dec 2010
                            • 469

                            #14
                            Me neither. The thread is very old, though. Likely the attachments did get lost when the website setup was moved to a new server?

                            Comment

                            Latest Articles

                            Collapse

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, 06-05-2026, 10:09 AM
                            0 responses
                            17 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 06-04-2026, 08:59 AM
                            0 responses
                            34 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 06-02-2026, 12:03 PM
                            0 responses
                            37 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 06-02-2026, 11:40 AM
                            0 responses
                            24 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...