[guilhem]

Thanks for all of your advices!
I did not know about BBMap software, thank you!
Is it faster as Hisat2? I have billions of read to map, although I think I will try for now to restrict my mapping to the transcriptome (especially for Eukarotic genome) -- full genome is very slow.

[GenoMax]

If you have a multi-core machine, BBMap will be fast. Use the threads=N option to start with available threads.

[zorgster]

Normally, I use the defaults But for 30bp ribosomal reads, you could add "maxindel=10" (just a random small number I picked). Searching for long indels (which BBMap does by default) is not necessary when aligning to ribosomes (which as far as I know are never spliced); [...]

[...] with any mismatches, or quality-trim to Q30 prior to mapping, etc. These are almost never good ideas! They are typically devised by biologists on the assumption that "My data has variable quality, and is annotated with its actual quality. Therefore, if I throw away low-quality data, my results will be strictly better."

I was here for adapter clipping. But thought I'd add something to this old post:

1. https://www.ncbi.nlm.nih.gov/books/NBK21729/ (Molecular Cell Biology) summarises:
- "Like pre-mRNAs, the primary transcripts produced from pre-rRNA and tRNA genes undergo extensive processing." - some of the processes are described in the linked chapter. Some things to be aware of if aligning to rRNA...

2. Low quality reads... I have just such reads to back this up... what does Q2 mean here? The reads line up - but the sequence was still read where the quality was #/Q2. To me that looks like a valid read. [Read ID anonymised to SRR888888]

@SRR888888.19.1 19 length=76
CCCCCATGGAGCACAGGCAGACAGAAGCCCCCGCCCCAGCTCTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGC
+
=<7<=<AABCBBABB3?+<A<B>@A###################################################
@SRR888888.20.1 20 length=76
CCCCATGGAGCACAGGCAGACAGAAGTCCCCGCCCCAGCTGTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGCT
+
@@@DDBDDF?BBF?FE=EE1CFDCFHBC<CEFDFA@@F>AGDG@FEHE>EEH>=CCED?CCCC<@@@@CCACCCA@
@SRR888888.29.1 29 length=76
CAGCTGTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCACACAGTGCTGGTTCCGTCACCCCCTCC
+
@@@FFFDE<DFHBAGGEGIHIB@GIIIGIIAHIGIIIGIGHGCHIIIIICFH;FHGGIII@C=?AEHBBCBCCCCC


Oliver
[biologist and programmer ]