Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • frymor
    Senior Member
    • May 2010
    • 151

    running DEXSeq with hisat2 created bam files

    Hi,

    I am trying to run DEXSeq with bame files made by the hisat2 mapper. I have created the gff file according to the manual. I have seen that the chromosome names are different from the bam files, so I have awk-modified them. now they both look similar.

    I have attached here the first 1000 rows of the gff file as well as 400 of the bam file from hisat2.
    here are the first few rows of both files:
    Code:
    [B]gff[/B]:
    1       dexseq_prepare_annotation.py    aggregate_gene  11869   14409   .       +       .       gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     11869   12009   .       +       .       transcripts "ENST00000456328.2"; exonic_part_number "001"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12010   12057   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "002"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12058   12178   .       +       .       transcripts "ENST00000456328.2"; exonic_part_number "003"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12179   12227   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "004"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12613   12697   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "005"; gene_id "ENSG00000223972.5"
    
    [B]bam[/B]:
    SOLEXA3_1:8:54:9864:6930/2      433     1       10536   1       50M     16      90128665        0       TACCCCCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      ##################################################      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:2  XO:i:0  XG:i:0NM:i:2   MD:Z:4A19C25    YT:Z:UP NH:i:8
    SOLEXA3_1:8:96:12216:10104/2    401     1       10536   1       50M     =       532371  0       TACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      BBCB<>=@:=)BCCCBCCDC@@@@:C>C@CCCCCC@CCCBACCBCCCCCC      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1MD:Z:24C25       YT:Z:UP NH:i:6
    SOLEXA3_1:8:38:7825:12181/2     177     1       10537   1       50M     2       61785065        0       ACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTC      #########B-A6=0;6<:6:66:*;34:.ABBA?7>AA=ABC?C@DBCC      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:1  XO:i:0  XG:i:0NM:i:1   MD:Z:23C26      YT:Z:UP NH:i:6
    SOLEXA3_1:8:102:12459:18067/1   337     1       10540   1       50M     19      238009  0       ACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCC      BCCCCCC@CCCCCCCCCCCCCCCCCCCBCCCCCCCCCCCCCCCCCCCCCC      AS:i:-5 ZS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1MD:Z:20C29       YT:Z:UP NH:i:4
    SOLEXA3_1:8:63:4265:15899/2     153     1       10565   255     50M     =       10565   0       CAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAAC      A@<BB=B@BB2/5..(*0*/>CB>@BBC@B??;?9?C=C=<<78:;<;;<      AS:i:0  ZS:i:-2 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0MD:Z:50  YT:Z:UP NH:i:1
    When running the command:
    Code:
    python ~/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py -p yes gencode.v23.annotation.mod.gff $file DEXSeq_completeSample/$NEW_FILE.txt
    I keep getting the following error message:
    Code:
    Traceback (most recent call last):
      File "/home/yeroslaviz/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py", line 215, in <module>
        for af, ar in HTSeq.pair_SAM_alignments( reader( sam_file ) ):
      File "/usr/local/lib/python2.7/dist-packages/HTSeq-0.6.1p1-py2.7-linux-x86_64.egg/HTSeq/__init__.py", line 601, in pair_SAM_alignments
        for almnt in alignments:
      File "/usr/local/lib/python2.7/dist-packages/HTSeq-0.6.1p1-py2.7-linux-x86_64.egg/HTSeq/__init__.py", line 536, in __iter__
        algnt = SAM_Alignment.from_SAM_line( line )
      File "_HTSeq.pyx", line 1276, in HTSeq._HTSeq.SAM_Alignment.from_SAM_line (src/_HTSeq.c:24611)
    ValueError: ('SAM line does not contain at least 11 tab-delimited fields.', 'line 1 of file hisat2.bamFiles/610W1AAXX_8.sorted.bam')
    the first line of the bam file looks like that:
    Code:
    SOLEXA3_1:8:54:9864:6930/2      433     1       10536   1       50M     16      90128665        0       TACCCCCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      ##################################################      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:2  XO:i:0  XG:i:0NM:i:2   MD:Z:4A19C25    YT:Z:UP NH:i:8
    Has anyone ever tried to run DEXSeq with the hisat2 output?
    Is there a difference to the "standard" sam/bam format?

    I would appreciate any help solving this error message.

    thanks
    Assa
    Attached Files

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
15 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
29 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
16 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Working...