Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • fh331
    Member
    • Apr 2016
    • 19

    #16
    Originally posted by SylvainL View Post
    Looking at your reads, it seems you had a problem when you extracted them from the CRAm files. They look exactly similar with a shift of 3-4 bp...
    I peeked into the original cram file using the following command and the result is the same Fastq. So i don't know if the Cram decompression to Fastq has caused the problem:

    fazal@fazal-Precision-T1700:/media/fazal/backup/BCL11A/Cram$ java -jar /opt/cramtools-3.0.jar fastq -I 18418_2#1.cram | head -20
    @HS32_18418:2:2307:11553:47098#1/1
    CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
    +
    BBBBBBF/FFFFFFFFFFFFFFFFFFFFFFFFFFFBBFFFB</<FFFF//FFFFFFFBBF<FFFFFFBF/B<FF/
    @HS32_18418:2:2307:11553:47098#1/2
    TAACCCTACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTTACCCTAACCCTAACCCAAC
    +
    </FBB<///F<BF/B/F<FB<<FB<B<FFF/BFFBFBBB<FFB<FFFFBFFFFFF<FFFF/FFBFFF<FFBBBBB
    @HS32_18418:2:1201:20716:93279#1/2
    ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC
    +
    BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFF//FFB
    @HS32_18418:2:1201:20716:93279#1/1
    AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAAAC
    +
    /<FFF</<FBF<</FFFBF<FFFFBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBBBBB
    @HS32_18418:2:1102:8324:84406#1/1
    CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAAACCCTA
    +
    BBBB</<<FFFFFBBF<<BFFBB/F/<<<<F/FFFFFBBB<F//B/F/<FBFFB//</BFFBB/</////</7/<

    Comment

    • fh331
      Member
      • Apr 2016
      • 19

      #17
      Originally posted by HESmith View Post
      These sequences (CCCTAA) are from the telomere repeat. CRAMs are sorted files so, depending on the reference used for alignment, it's not unusual to see all of these reads at the beginning of the file.

      What IS unusual is that both reads are from the same strand, when one should be the reverse complement of the other (e.g., TTAGGG). Not sure how that happened, but it's likely to be the reason why realignment failed.
      Hi HESmith,
      Bear with me for the silly and naive question i am about to ask: In PE chipseq, pair of reads should be completely reverse complementary to each other or there is like a region in which the reads are reverse complementary?

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #18
        Originally posted by fh331 View Post
        Hi HESmith,
        Bear with me for the silly and naive question i am about to ask: In PE chipseq, pair of reads should be completely reverse complementary to each other or there is like a region in which the reads are reverse complementary?
        They will only be completely rev-comp of each other, IF the insert size=number of F/R sequencing cycles (not likely for every fragment in your library).

        Comment

        • fh331
          Member
          • Apr 2016
          • 19

          #19
          Originally posted by SylvainL View Post
          Are you sure the reads in file 1 and file 2 are in the same order? Just print the first 5 reads of each file...

          You can also try to map only one file (not considered as paired-end then) to see the percentage of mapped reads...
          Hi SylvainL,
          I tried to align single file from the PE. Here's the output report and worked fine i think:

          fazal@fazal-Precision-T1700:/media/fazal/backup/BCL11A/FastQ_Files$ bowtie -m 1 -S /media/fazal/backup/BCL11A/Bowtie_Indices/Bowtie1_Index/human_g1k_v37.fasta 18418_2-1_1.fastq > /media/fazal/backup/BCL11A/Sam_from_FastQ/18418_2-1_1.sam
          # reads processed: 40095362
          # reads with at least one reported alignment: 33362937 (83.21%)
          # reads that failed to align: 2434332 (6.07%)
          # reads with alignments suppressed due to -m: 4298093 (10.72%)
          Reported 33362937 alignments to 1 output stream(s)

          No I don't know what's going wrong with aligning the two PEs together?

          I am kind of getting frustrated

          Comment

          • fanli
            Senior Member
            • Jul 2014
            • 197

            #20
            Like @HESmith said, you may have a problem with the orientation of your read pairs.

            The default orientation for valid alignments in bowtie1 is --fr. If your read pairs got converted somehow to ff, then none of the alignments would be valid.

            Comment

            • SylvainL
              Senior Member
              • Feb 2012
              • 180

              #21
              Probably the wrong orientation came from the exportation of the reads from the CRAM files. As fanli said, change the setting in bowtie (or reverse complement the reads 2)

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                Yesterday, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Yesterday, 02:55 AM
              0 responses
              9 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              12 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-23-2026, 11:41 AM
              0 responses
              12 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-20-2026, 11:10 AM
              0 responses
              24 views
              0 reactions
              Last Post SEQadmin2  
              Working...