How do I convert one file into several multifasta fasta files using perl

[iMarcelo]

Hi
It's the first time I work with Perl then I don't know so much about the language.
I need a script which converts multi-fasta file in several different fasta file.
For example:

In multi-fasta file contains:

>seq1
CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGT
>seq2
GACGTGCTGCTGGAGATCGCCACGCCGGGTCGCTCGTTCTGTAAGCGGATGTCGATATTGGTTGACTGAT
AGCTGGCGCGCGGTAGCATCTCGAACATGCGTTCGAGACCAGAGACGGGGCATGTAGA
>seq3
CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGT

I want to convert this multifasta file into several output files fasta:

file1.fasta
>seq1
CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGT

file2.fasta
>seq2
GACGTGCTGCTGGAGATCGCCACGCCGGGTCGCTCGTTCTGTAAGCGGATGTCGATATTGGTTGACTGAT
AGCTGGCGCGCGGTAGCATCTCGAACATGCGTTCGAGACCAGAGACGGGGCATGTAGA

file3.fasta
>seq3
CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGT

Remembering: must be in perl

[GenoMax]

Is this a homework assignment? If it is then you may want to show what you have done so far to get help.

[vivek_]

#!/usr/bin/env perl

use strict;
use warnings;
use IO::File;

my $usage = "\nUSAGE: perl $0 <Fasta>"."\n";
print $usage and exit unless($ARGV[0]);
my $fh  = IO::File->new("$ARGV[0]");
my $out = "";


while(my $line = $fh->getline)
{
    chomp($line);
    if($line =~ /^>/)
    {
	if($out ne "")
	{
	    $out->close;
	}
	$line =~ s/^>//;
	$out  = IO::File->new("> $line.fa");
	print $out ">".$line."\n";
    }
    else
    {
	print $out $line."\n";
    }
}

$fh->close;
$out->close;

[GenoMax]

@vivek: This may be a homework assignment. In that case you don't want to provide ready code. @iMarcelo is not going to learn this way.

[vivek_]

My bad, I thought it might be a technician struggling with a task. I'll remove it but if he is subscribed to e-mail notifications, he'll get the post in e-mail anyways.

[GenoMax]

That is ok. Your code used modules and a beginner student probably would not be expected to know that. iMarcelo may not be able to use that code, in that case.

The part about it has to be perl is why I thought this may be homework.

[iMarcelo]

No, it isn't a homework assignment. It's a task in my job. I have no knowledge in perl language,
I have always done my tasks in Java or C, but the person who works with perl is on vacation, so my boss gave me this task to do. I am doing research on this, but still no success.
So who can help me, thank you.

[GenoMax]

While @vivek puts his code back up you can use http://hgdownload.cse.ucsc.edu/admin...x86_64/faSplit utility from Jim Kent to do this very efficiently.

If you know Java/C then the end result should be the same as using perl if you used one of those languages.

[vivek_]

No, it isn't a homework assignment. It's a task in my job. I have no knowledge in perl language,
I have always done my tasks in Java or C, but the person who works with perl is on vacation, so my boss gave me this task to do. I am doing research on this, but still no success.
So who can help me, thank you.

I have reposted the code.

[iMarcelo]

I have reposted the code.

Thank you so much @vivek.

I have difficulty working with languages that I've never worked before, and I had to do this task for my boss urgently.

I will continue doing research on this language for me to learn more for future tasks.

[iMarcelo]

While @vivek puts his code back up you can use http://hgdownload.cse.ucsc.edu/admin...x86_64/faSplit utility from Jim Kent to do this very efficiently.

If you know Java/C then the end result should be the same as using perl if you used one of those languages.

Yes, the end result is the same, but my boss wanted in Perl, I don't know why.

Thank you for your help.