Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • emacalate
    Junior Member
    • Dec 2014
    • 1

    ATAC-seq (Read1/Read2/Index Sequencing Primers?)

    Hi,

    We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

    Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
    Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

    Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers?

    I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded?

    Any help would be greatly appreciated!

    Thanks,

    Steve
  • SeleneT
    Junior Member
    • Aug 2016
    • 2

    #2
    ATAC sequencing primers

    Hello,
    if you're sequencing on Illuminas NextSeq, their sequencing kits higher than v2 include Nextera primers.
    I presume the most recent versions of HiSeq kits should be the same, though I've yet to sequence with them, so check with Illumina tech support or whomever you'll be sequencing with to be sure.
    If not, or you're planning to use an older chemistry version kit, the Nextera kit should have come with indexing primers. Check with Illumina's web site for correct dilutions to add, or your sequencing service provider should be able to help. Happy sequencing!
    Selene.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 11:41 AM
    0 responses
    9 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    21 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    34 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    44 views
    0 reactions
    Last Post SEQadmin2  
    Working...