Merging illumina V4 paired end reads

[rEDI]

Hi

I am having difficulty understanding how my merged reads are producing a certain amplicon size.

Basically, I have 2 x 251bp reads. This 251bp includes primer sequence, of as far as I understand, 20bp.

When these 251bp reads are merged, they produce an amplicon size of 291bp.

Here is an example of a merged read with amplicon length of 291bp (there are two N's in the sequence as haven't run screen.seqs yet)

>M01822_319_000000000-AG4CF_1_1101_16954_1171
GTGCCAGCCGCCGCGGTAATACATAGGATGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGAGCGCAGGCGGATTTACAAGTCTGATGTTAAAGACAACTGCTTAACGGTTGTTTGCATTGGAAACTGTAAGTCTAGAGTATAGTAGAGAGTTTTGGAACTCCATGTGGAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGAGGCGAAGGCGAAAACTTAGGCTATAACTGACGCTTAGGCTCGAAAGTGTGGGNAGCAAATAGGATTAGATACCCCGGTAGTCN

I have looked at the make.contigs report file and it seems to report that the following (if I am understanding correctly);

Length = 291bp
Overlap length = 211 bp
Total primers = 40bp

Therefore, is the read length 251bp, but merged read length 291bp (as forward and reverse primers included)?

What I don't understand is that each primer length is 20bp, so should the amplicon not be 271bp?

I know I have to remove the primers, but just trying to understand this.

Any help would be greatly appreciated.

Thank you

[fanli]

What are your primer sequences? Are they on each end of the merged 291bp contig? From what you're saying, it sounds to me like 291 - 20 - 20 = 251...

Relatedly, you really should only have 2x250, not 2x251. The last cycle is used for quality scoring of the previous cycle.

[rEDI]

Hi Fanli

Thank you for your answer

The primer seqs are as follows:

forward
GTGCCAGCCGCCGCGGTAA

reverse
GGACTACACGGGTATCTAAT

They appear to be on each end of merged contig, but each read is 251bp including the primer (so ~231bp excluding the primer).

The overlap, according to the report file after merging, indicates that there is 211bp of overlap.

Which means that the only way I can make sense of this is 211+20+20=251bp read for both forward and reverse, that has assembled into a 291bp contig.

i.e. 211+20+20 (F) +20+20 (R) = 291bp?

What do you think?

Thank you again

[fanli]

I think we're in agreement - does the attached diagram help?

[rEDI]

That is perfect, thank you so much for explaining Fanli. That is most helpful

One more question - do the seqs unique to R1 and R2 not merge in this case, or are they merged regardless?

Thank you again

[fanli]

They are merged as well - the full 291bp sequence from your original post is what you get. Another way to think about this is that you are sequencing a 251bp amplicon with 20 bases on each end unique to R1 or R2 and 231 bases in the middle covered by both.

[rEDI]

Thank you Fanli. In this case is it however that only 211 bases are covered by both?

[fanli]

Sorry, yes. 211 bases in the middle - math is hard :/

[rEDI]

Thank you again for your very helpful answers