Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • rEDI
    Member
    • Apr 2016
    • 14

    Merging illumina V4 paired end reads

    Hi

    I am having difficulty understanding how my merged reads are producing a certain amplicon size.

    Basically, I have 2 x 251bp reads. This 251bp includes primer sequence, of as far as I understand, 20bp.

    When these 251bp reads are merged, they produce an amplicon size of 291bp.

    Here is an example of a merged read with amplicon length of 291bp (there are two N's in the sequence as haven't run screen.seqs yet)

    >M01822_319_000000000-AG4CF_1_1101_16954_1171
    GTGCCAGCCGCCGCGGTAATACATAGGATGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGAGCGCAGGCGGATTTACAAGTCTGATGTTAAAGACAACTGCTTAACGGTTGTTTGCATTGGAAACTGTAAGTCTAGAGTATAGTAGAGAGTTTTGGAACTCCATGTGGAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGAGGCGAAGGCGAAAACTTAGGCTATAACTGACGCTTAGGCTCGAAAGTGTGGGNAGCAAATAGGATTAGATACCCCGGTAGTCN

    I have looked at the make.contigs report file and it seems to report that the following (if I am understanding correctly);

    Length = 291bp
    Overlap length = 211 bp
    Total primers = 40bp

    Therefore, is the read length 251bp, but merged read length 291bp (as forward and reverse primers included)?

    What I don't understand is that each primer length is 20bp, so should the amplicon not be 271bp?

    I know I have to remove the primers, but just trying to understand this.

    Any help would be greatly appreciated.

    Thank you
  • fanli
    Senior Member
    • Jul 2014
    • 197

    #2
    What are your primer sequences? Are they on each end of the merged 291bp contig? From what you're saying, it sounds to me like 291 - 20 - 20 = 251...

    Relatedly, you really should only have 2x250, not 2x251. The last cycle is used for quality scoring of the previous cycle.

    Comment

    • rEDI
      Member
      • Apr 2016
      • 14

      #3
      Hi Fanli

      Thank you for your answer

      The primer seqs are as follows:

      forward
      GTGCCAGCCGCCGCGGTAA

      reverse
      GGACTACACGGGTATCTAAT

      They appear to be on each end of merged contig, but each read is 251bp including the primer (so ~231bp excluding the primer).

      The overlap, according to the report file after merging, indicates that there is 211bp of overlap.

      Which means that the only way I can make sense of this is 211+20+20=251bp read for both forward and reverse, that has assembled into a 291bp contig.

      i.e. 211+20+20 (F) +20+20 (R) = 291bp?

      What do you think?

      Thank you again

      Comment

      • fanli
        Senior Member
        • Jul 2014
        • 197

        #4
        I think we're in agreement - does the attached diagram help?
        Attached Files

        Comment

        • rEDI
          Member
          • Apr 2016
          • 14

          #5
          That is perfect, thank you so much for explaining Fanli. That is most helpful

          One more question - do the seqs unique to R1 and R2 not merge in this case, or are they merged regardless?

          Thank you again

          Comment

          • fanli
            Senior Member
            • Jul 2014
            • 197

            #6
            They are merged as well - the full 291bp sequence from your original post is what you get. Another way to think about this is that you are sequencing a 251bp amplicon with 20 bases on each end unique to R1 or R2 and 231 bases in the middle covered by both.

            Comment

            • rEDI
              Member
              • Apr 2016
              • 14

              #7
              Thank you Fanli. In this case is it however that only 211 bases are covered by both?

              Comment

              • fanli
                Senior Member
                • Jul 2014
                • 197

                #8
                Sorry, yes. 211 bases in the middle - math is hard :/

                Comment

                • rEDI
                  Member
                  • Apr 2016
                  • 14

                  #9
                  Thank you again for your very helpful answers

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    Yesterday, 11:48 AM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    07-08-2026, 05:17 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, Yesterday, 11:10 AM
                  0 responses
                  9 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-13-2026, 10:26 AM
                  0 responses
                  30 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-09-2026, 10:04 AM
                  0 responses
                  41 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-08-2026, 10:08 AM
                  0 responses
                  26 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...