Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Johnwang
    Member
    • Jun 2016
    • 17

    #1

    low clustering and bad sequencing primer efficiency on NextSeq 500

    I got low clustering and very bad sequencing primer efficiency on NextSeq 500 run in my MIP project. The sequencing primers (read1, read2 and two index primers) are customized. We have tried either to spike our primer into illumina sequencing primer wells or add them into optional wells which are designed specifically for costumer specific primers. Both didn't give use any sequencing results. Do anyone have any suggestions ? thanks.

    Does any know what is typical Tm for sequencing primers from illumina ? Looks like our customer specific primers don't anneal to reads very well. Is there anything that I can do to improve it in our Nextseq 500 run ? Thank you in advance.
    Last edited by Johnwang; 09-02-2016, 06:45 AM.
  • luc
    Senior Member
    • Dec 2010
    • 469

    #2
    Attached are the recommendations from Illumina, I believe people often use 5 degree higher Tms (using the default IDT oligoanalyzer calculations).
    Attached Files

    Comment

    • Yepler
      Member
      • Oct 2010
      • 22

      #3
      If you're still having the issue, send me a message; I had to do some dancing to get custom primers to work on the NextSeq and might be able to help out.

      Comment

      • Johnwang
        Member
        • Jun 2016
        • 17

        #4
        Thank you. Here are primers used for MIP amplification and NextSeq.

        Example of amplicon amplified with P7 and P5 in primers respectively:

        REV_index6 CAAGCAGAAGACGGCATACGAGATCATGCCTAACACGCACGATCCGACGGTAGTGT
        Index 6
        FOR_index5 AATGATACGGCGACCACCGAGATCTACACACTGCATACATACGAGATCCGTAATCGGGAAGCTGAAG
        Index 5
        Custom primers used:
        MIP_SEQ_FOR CATACGAGATCCGTAATCGGGAAGCTGAAG
        MIP_SEQ_REV ACACTACCGTCGGATCGTGCGTGT
        SEQ_index7 ACACTACCGTCGGATCGTGCGTGT
        SEQ_index5 TTCAGCTTCCCGATTACGGATCTCGTATG

        Comment

        • Yepler
          Member
          • Oct 2010
          • 22

          #5
          Sorry it took me a few days to check back. I might have identified your problem, although it might also be colored by my own experiences.

          I have quite small-insert libraries, and while they are homemade, they come out looking like standard Illumina dual-sided barcoded libraries. The only real difference is that the main read is sequenced with the Small RNA Sequencing Primer (from Illumina), which has a Tm of about 69 C, while the other Read1 primers in Illumina's mix have Tms around 74 C. When I tried sequencing my libraries on the NextSeq, what I saw was two lanes of decent sequence and two lanes of all Gs. If you know the NextSeq, you know that all Gs means (basically) that the cluster didn't sequence. But the cluster itself DID demultiplex, so the two index reads were successful.

          I should point out here before someone asks - yes, I'd sequenced these libraries extensively on MiSeq and HiSeq prior to my NextSeq Adventures. I do a lot of sequencing! Anyhow, after a lot of back and forth with Illumina, we finally hit on the Tm of the Small RNA Sequencing Primer.

          I couldn't make the primer longer, because there wasn't any extra room, so instead, I added LNA bases to bring the Tm up to ~74 C. I added the LNA primer to the Read1 custom position, and out came some gorgeous sequencing.

          So...I quickly put your primer sequences through IDT's Tm calculator, and the Tms are pretty low. Can you increase them, either via length, or via LNAs, to nearer to 74?

          I may be off the mark here, so feel free to send more details back. But after my headache, I'd look at Tm first.

          Oh, and the other thing that might be helpful is to make sure that a "standard" library (you could use PhiX, in a pinch) DOES sequence well. I was lucky enough to have a very similar library that used the standard Read 1 primer, and that helped narrow down the issue.

          Comment

          • Johnwang
            Member
            • Jun 2016
            • 17

            #6
            Hi Yepler, thanks for your response with suggestions. As you mentioned, my Tm is pretty low when you checked it on IDT oligo analyzer. I looked it on exiqon, it is close to 70C. I can do LNA to increase Tm of my sequencing primer up to ~74C based on the exiqon calculation, but will still be 65C on IDT. So assume, I just do LNA and trust Tm with exiqon. Any other suggestions? such as length of oligo and position of LNA. Thank you again.

            John

            Comment

            • Yepler
              Member
              • Oct 2010
              • 22

              #7
              I used the Read 1 Sequencing Primer from Illumina as a baseline for the Tm calculations ('cause yes, all calculators seem different!).

              There are now three LNA bases in my primer, in the middle of the primer, (in a pattern like this: LNA-base-base-LNA-base-base...). Don't put an LNA base at the 3' end as a "clamp" - that sounded like a good idea but ended up giving some very strange results.

              Hope that helps and good luck.

              Comment

              • Johnwang
                Member
                • Jun 2016
                • 17

                #8
                Hi Yepler,
                Many thanks for your inform and suggestions. By the way, quick question for LNA oligos, is Standard Desalting good enough ? or have go with HPLC purity.

                Comment

                • Johnwang
                  Member
                  • Jun 2016
                  • 17

                  #9
                  my sequencing primer

                  Hi Yepler,
                  Here are my sequencing primers, would you please take a look and tell me if you have any suggestion. Thank you.

                  CTACCGTCGGAT+CGTG+CGTGT
                  ACGAGATCCGTAATC+GGGAA+GC+TGAAG

                  Comment

                  • Yepler
                    Member
                    • Oct 2010
                    • 22

                    #10
                    To the best of my ability to tell, I think those should work out for you. Good luck, and please do let me know how it turns out.

                    Comment

                    • Johnwang
                      Member
                      • Jun 2016
                      • 17

                      #11
                      new sequencing primers

                      Hi Yepler, the run with new sequencing primers worked perfectly. Thanks.

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      17 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      33 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      23 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-23-2026, 11:41 AM
                      0 responses
                      21 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...