Hey, let's talk about mate pairs and MiSeq

[MicroMicro]

Hi all, I'm new to posting but have been using this site for reference for about a year now.

I'm analyzing a bacterial genome sequenced on a MiSeq for a lab that's unfamiliar with sequencing and bioinformatics. So, first up, does anyone have tips for figuring out if a run has been done with paired ends by looking at the data?

Second, does all MiSeq data have mate pairs? Illumina's website doesn't explicitly state this. Does anyone know of a good, LABLED figure illustrating this?

[Brian Bushnell]

MiSeq can produce paired or unpaired data depending on the run configuration. Paired data is pretty easy to spot - there will either be two output fastq files (typically with identical names except for "R1" or "R2" near the end of the name), or else there will be one file interleaved. For an interleaved file, the names of the first two reads will be identical except that after the first whitespace, one will have "1:" and the other "2:". For example, this is the first 4 lines of an interleaved NextSeq fastq:

@NS500302:178:HLNGJBGXY:1:11101:23298:1057 1:N:0:GTAGAG
TATGGNCGAGAGCCGCAGGCAATAACAANTTNTTNAGCGGTTAGTGTTTCAACGCTGCCGTCCGGGCAATCCAGCGCCAACGTATGCTCGTCAACAAAGCGAGCGTTTCCCTGCAATATTTCACAGTGATTACGTTCGTAAAATCCCTGAC
+
@CCCC!FFFF@FFFFFFFFFFFFFEFFF!FF!FF!FFCFFFFFFFFFFFCFDFFCFFFFFFFFFFFFFFFFFEEFDFFFFFFFFFFFFEFFFDFFF<FEEECEBDEEFDDDFEEFFFFFCFBCD?DFECFFFEE=FFFFFFEFFF=EFFAB
@NS500302:178:HLNGJBGXY:1:11101:23298:1057 2:N:0:GTAGAG
TGCTCCGCTCTTCTTTTGCCGATATCCTTAACCATGCCGATAACGTGATTAATCAACAAACGCGCATGCGTCAGGGATTTTACGAACGTAATCACTGTGAAATATTGCAGGGAAACGCTCGCTTTGTTGACGAGCATACGTTGGCGCTGGA
+
@@CCCFFFFFFFFFEFFFFFFFFFFFFFFFEFFFFFFFFFFFFFFFFFFFFEFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF<EFFFFAFFFFFFFFFFFFFFFFF?FEFFFFFFFFFFFFFFFFFFFFFEEFFADBBFF

[MicroMicro]

Thanks Brian! I have two files so that clears things up considerably.

Still looking for a good figure if anyone out there has one

[GenoMax]

Mate-pair has a certain meaning (which is not the same as paired-end reads). Sequence is always represented as 5' --> 3' for R1 and R2.

Simply R1 - R2 files represent fragment(s) sampled from the two ends.

R1  ------------------->
     -------------------------------------------------------  DNA Fragment
                                             <--------------   R2

[ronaldrcutler]

Figures 6B and 6C should answer the mate pair question: http://www.illumina.com/documents/pr...c_sequence.pdf

[thermophile]

Ask the lab what library construction kit they used. I doubt it would be mate pair if this is their first library-more likely something like nextera or truseq which are paired end sequencing of ~350-550 bp fragments