Spiking custom primers failed on Miseq runs

[katinka03]

Hi all,

I would like to know if somebody encountered the same problem as we do at the moment.
Since Mid February we are no longer able to spike our Fluidigm custom primers (CS1 and CS2) into the Illumina primers (Miseq V2 nano kit 500 cycles).
We tried now 4 times with different libraries and also with a library that worked before but got no results but PhiX reads.
When we used the CS1 and CS2 primers as custom primers alone the library was read as usual.
We tested the primers with our libraries in a normal pcr and they gave perfectly strong signals.

Thanks

[thermophile]

Have you tried new aliquots of the primers? PCR would work but sequencing fail if the primers are mixed up (R1 in R2 well, R2 in R1 well)

[katinka03]

As usual, in the beginning we were assuming the error to be on our side and we had the same idea: mixed primer directions. But we have used the same primers without Illumina primers as custom read primers and they worked.
And we spiked the Fluidigm primers as pairs into Illumina primers and this did not work.
We just wonder if we are the only ones having troubles or if this is something new and others are struggling the same way?

[thermophile]

you could order the primers that hit phix and put those with your custom primers in the custom primer wells.

These are the primers that should hit phiX (I haven't tested them but this is what FAS told me to order)

Illumina.phix.R1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina.phix.R2
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

[katinka03]

This is a very good idea! Thanks, I will definitely try it.