Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • cnicolas
    Junior Member
    • Aug 2016
    • 4

    just 2.4% by trimming at 27. i do not know if it's a good average for a 2x300bp, MiSeq 16s and a metaprofilig of another marker

    Comment

    • WhatsOEver
      Senior Member
      • Apr 2012
      • 215

      Is the command you posted, when you got the error the first time copy/paste from your terminal? In that case you simply made the mistake to only load the reverse reads
      That may also fit to the error message you got as you would have lost all mates. Interesting, however, that bbduk didn't complain and even produced two fastqs as output?!

      Originally posted by cnicolas View Post
      /data/umb/cichocki/bbmap/bbduk.sh in=/data/umb/cichocki/project2/bbduckdu11avril/project2_R2.fastq in=/data/umb/cichocki/project2/bbduckdu11avril/project2_R2.fastq out1=clean11avril.fastq out2=clean211avril.fastq qtrim=rl trimq=30

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        Originally posted by WhatsOEver View Post
        Is the command you posted, when you got the error the first time copy/paste from your terminal? In that case you simply made the mistake to only load the reverse reads
        That may also fit to the error message you got as you would have lost all mates. Interesting, however, that bbduk didn't complain and even produced two fastqs as output?!
        Ah! Good eye...

        OK, so here's what's happening:

        Code:
        in=x.fq in=x.fq
        In1 is set as x.fq. Then, in1 is set as x.fq again (you can do this as many times as you want; BBTools all just overwrite the previous setting with the latest setting). Then, since 2 output files are specified, BBDuk assumes that the input file is interleaved and forces interleaved mode to true. That's a feature, by the way! But, I guess one that could potentially cause problems.

        Comment

        • mslider
          Junior Member
          • Sep 2010
          • 25

          --Hi,

          i have a big difference between results using bbduk.sh and trimmomatic trimming single-end reads, i have used the commands below, trimmomatic kept 99.78% survival reads whereas bbduk 91.76%. I don't know which to consider good or not.
          Which parameters do you use to use to trim in a good way single-reads ?

          thank you --

          java -Xmx10g -jar trimmomatic-0.36.jar SE -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:TruSeq3-SE.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

          TrimmomaticSE: Started with arguments:
          -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:/home/jtazi/save/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:
          2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
          Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
          Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
          ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
          Input Reads: 49512700 Surviving: 49401731 (99.78%) Dropped: 110969 (0.22%)

          bbduk.sh Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=13 ktrim=r useshortkmers=t mink=5 qtrim=rl minlength=36 trimq=27

          BBDuk version 36.11
          Set threads to 8
          maskMiddle was disabled because useShortKmers=true
          Initial:
          Memory: max=8232m, free=7974m, used=258m

          Added 2017 kmers; time: 0.570 seconds.
          Memory: max=8232m, free=7545m, used=687m

          Input is being processed as unpaired
          Started output streams: 0.449 seconds.
          Processing time: 118.446 seconds.

          Input: 49512700 reads 2475635000 bases.
          QTrimmed: 7288815 reads (14.72%) 218452414 bases (8.82%)
          KTrimmed: 3125475 reads (6.31%) 23413723 bases (0.95%)
          Total Removed: 4077445 reads (8.24%) 241866137 bases (9.77%)
          Result: 45435255 reads (91.76%) 2233768863 bases (90.23%)

          Time: 119.548 seconds.
          Reads Processed: 49512k 414.16k reads/sec
          Bases Processed: 2475m 20.71m bases/sec

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            The difference is primarily because you are quality-trimming to Q27, which is too high for almost any purpose. I'd suggest a command more like this:

            Code:
            bbduk.sh -Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=19 mink=5 hdist=1 hdist2=0 ktrim=r qtrim=r minlength=36 trimq=14

            Comment

            • mslider
              Junior Member
              • Sep 2010
              • 25

              --Hi,

              thank you for your answer, just a question about quality check:
              trimq=14 means an average quality in a sliding window such as in Trimmomatic with SLIDINGWINDOW:4:15 or not ?

              best -

              Comment

              • Brian Bushnell
                Super Moderator
                • Jan 2014
                • 2709

                BBDuk supports a sliding window; the flags "qtrim=w,4 trimq=15" will give similar behavior to Trimmomatic. But I don't recommend that; the Phred trimming method used by default is optimal, whereas sliding-window trimming is non-optimal.

                Comment

                • mslider
                  Junior Member
                  • Sep 2010
                  • 25

                  okay good, thanks for your help.

                  Comment

                  • BrianS
                    Junior Member
                    • May 2017
                    • 2

                    I am using bbduk.sh to trim fastqs to a given length using the force trim capability. I noticed that the character # is being changed to ! in the Q score line of the trimmed fastq. I was unable to find documentation describing whether this is expected behavior. Would you be able to provide some insight into this? I ran the following command:

                    ../../tools/bbmap/bbduk.sh in=<sample>.fastq.gz out=<trimmed_sample>.fastq.gz ftr=50 ordered=t

                    Original fastq:
                    @SN1131:915:HFYN7ADXY:1:1101:21364:2052 1:N:0: CAACCACA
                    TTTCNCCACCACCACGTCGTTCTTGCGCCTCTTCTTGGCTTTCCGCTTGCGCTTGGGTATCTGGCTTGGGGGGCGGAGTGGATCCTGCTTTCTGGCGGAAA
                    +
                    @@@B#2=BFHFHHII<GHIIIHIIIBHIIIIIIIIIIIIGIIIGIIIIIIIHHEEEB;C@CDDCCCBBBBBB>BBBBBB?BCCCCCCCCCCCCCCCB<9>B


                    bbduk.sh output:
                    @SN1131:915:HFYN7ADXY:1:1101:21364:2052 1:N:0: CAACCACA
                    TTTCNCCACCACCACGTCGTTCTTGCGCCTCTTCTTGGCTTTCCGCTTGCG
                    +
                    @@@B!2=BFHFHHII<GHIIIHIIIBHIIIIIIIIIIIIGIIIGIIIIIII


                    Thank you,
                    Brian

                    Comment

                    • Brian Bushnell
                      Super Moderator
                      • Jan 2014
                      • 2709

                      Hi Brian,

                      That's intentional. The 5th base call is an N, which means the quality score should be 0 (!) not 2 (#). Some versions of Illumina software have bugs causing some Ns to be assigned quality scores above 0, or called bases to be assigned a quality score of 0. Neither of these cases should happen as they are mathematically contradictory, and can cause problems with downstream tools, so BBDuk automatically fixes both of them.

                      You can add the flag "changequality=f" to disable this behavior, but I don't recommend it.

                      Comment

                      • BrianS
                        Junior Member
                        • May 2017
                        • 2

                        That makes sense. Thank you.

                        Comment

                        • Torst
                          Senior Member
                          • Apr 2008
                          • 275

                          This behaviour is a bit un-Unix like?


                          bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31 out=/dev/null

                          Unspecified format for output /dev/null; defaulting to fastq.

                          Exception in thread "main" java.lang.AssertionError: /dev/null already exists; please delete it.

                          Comment

                          • GenoMax
                            Senior Member
                            • Feb 2008
                            • 7142

                            Originally posted by Torst View Post
                            This behaviour is a bit un-Unix like?
                            @Brian will have a more official answer but BBTools are pure Java and are coded to be OS agnostic (will run on any OS with Java).

                            Not specifying an "out" option with most BBTools produces all statistics without result output (giving you out=/dev/null effect).

                            Comment

                            • Brian Bushnell
                              Super Moderator
                              • Jan 2014
                              • 2709

                              Haha

                              The syntax would be:

                              bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31 out=stdout.fq > /dev/null/

                              But, you don't need to specify anything, as the default is to not print anything rather than writing to stdout, so just do this:

                              bbduk.sh in1=R1.fq.gz in2=R2.fq.gz loglog loglogk=31

                              Edit: @Genomax beat me by a minute

                              Comment

                              • phylloxera
                                Junior Member
                                • May 2017
                                • 5

                                Getting different results with bbduk command line vs geneious plugin

                                Hi,

                                I have been searching the default settings in the command line and still haven't identified the source of the discrepancy... Here is my linux command:

                                sh ~/bbmap/bbduk.sh in1=~/path/to/forwards.fastq.gz in2=~/path/to/reverses.fastq.gz out=~/path/to/output.fastq.gz ref=~/bbmap/resources/adapters.fa ktrim=r k=23 mink=11 hdist=1 minoverlap=24 tbo

                                result: 3628348 reads, 581467350 bases

                                and here is my plugin command from the geneious output:
                                java.exe -ea -Xmx100m -cp ...\currenjgi.BBDukF ktrim=r k=23 hdist=1 edist=0 mink=11 ref=adapters.fa minlength=10 trimbyoverlap=t minoverlap=24 qin=33 in=input1.fastq in2=input2.fastq out=output1.fastq out2=output2.fastq

                                result: 3628348 reads, 584214527 bases

                                the plugin command seems compatible with my data and the defaults in bbduk.sh. Any idea why 3M more bases in the plugin?

                                Thanks, Aaron

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  Today, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  Yesterday, 05:17 AM
                                • GATTACAT
                                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by GATTACAT
                                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                  07-01-2026, 11:43 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 10:04 AM
                                0 responses
                                8 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, Yesterday, 10:08 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-07-2026, 11:05 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...