Cutadapt trimming issues

[Bernadeta]

Hi, perhaps someone could advise me on the following issue.

I was trimming my paired-end reads with cut adapt using the following command:

cutadapt  -a [U]CTGTAGGCACCATCAATA[/U]GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --minimum-length 45 -o ~/Virus_S5_trimmed_min45_R1.fastq.gz -p ~/Virus_S5_trimmed_min45_R2.fastq.gz Virus_S5_R1.fastq.gz Virus_S5_R2.fastq.gz

I the ran FastQC for the trimmed reads and in the overrepresented sequences section for the read 2 I have sequences all of which contain ATTGATGGTGCCTACAG in their 5' followed by different gene sequences.

This sequence is from one of the adaptors (I underlined it in the code), but I don't understand why does the cutadapt not trimm it off.

Any help would be appreciated.