Nextera Miseq custom primers

[adziulko]

Hi,

I am new to deep sequencing and would like a little help. I am trying to design custom primers to use on one end of my fragmented DNA for a Nextera Miseq. I am wondering if my primers need any modifications such as phosphorylations to be able to bind to the chip, or if I can get away with discluding the i5/i7 sequences.

I have designed two primers (to match the P7 or P5 end that would be randomly inserted due the random inserts of tagmentation). My primer design looks like this:

Primer to be paired with P5:
5' CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC


Primer to be paired with P7:
5' AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC

*Red = P7/P5 ends complementing chip oligo
*Green = transposon adaptor sequence
*3' black end = transposon sequence
*Brown = complementing region to DNA

Please let me know if you see any problems in this design and let me know if you think it will work. Thanks.

[nucacidhunter]

I wonder if you could indicate what you are trying to do. Primers "complementing DNA region" is the same in both so it cannot be standard custom amplicon.

You would not need any modification on primers except phosphorothioate bond in some cases where 3' end protection is important.