Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • ge2sasag
    Member
    • Apr 2013
    • 43

    #1

    >90% aligned concordantly 0 times ChIP-seq Bowtie2

    Hi,

    I know this question have raised many times here and in other forums but I've tried everything other people suggested in previous posts and still can't figure it out where is the problem...... This is the output summary of Bowtie2 (I checked several times the target genome, hg19 and it's correct):

    21404130 reads; of these:
    21404130 (100.00%) were paired; of these:

    21196512 (99.03%) aligned concordantly 0 times
    104527 (0.49%) aligned concordantly exactly 1 time
    103091 (0.48%) aligned concordantly >1 times
    ----
    21196512 pairs aligned 0 times concordantly or discordantly; of these: 42393024 mates make up the pairs; of these:

    906397 (2.14%) aligned 0 times
    28296440 (66.75%) aligned exactly 1 time
    13190187 (31.11%) aligned >1 times
    97.88% overall alignment rate

    I have paired-end ChIP-seq data, 50 bp reads. These are my steps (in Galaxy):

    1) I groomed the fastq files to get fastqsanger (I checked if it's correct: Input FASTQ quality scores type --> Sanger & Illumina 1.8+)

    2) FastQC is ok for all samples, some adapter contamination.

    3) I trimmed using either TrimGalore or Trimmomatic (I get the same result using both) using forward and reverse files for each sample. I checked and I didn't missed up the forward and reverse samples (I run Bowtie2 using first file 1 and file 2 and also using first file 2 and second file 1 and I get the same result...)

    4) I mapped the trimmed files to hg19 genome using Bowtie2 with option -fr and I get the result shown above. No matter what I try, I always get the same with the different samples that I have. All of them have around 32% of reads with adapters which I trimmed. I have no idea what to do with this.

    Any suggestions or idea of where is the mistake? Am I missing something?

    Thank you very much in advance.

    Gema
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    It appears that your reads are not mapping concordantly. One possible reason is when you did the trimming you may not have used both files (R1/R2) at the same time which could have lead to reads being out of order in the two files. You should always trim paired-end data files together.
    Last edited by GenoMax; 07-13-2017, 07:44 AM.

    Comment

    • ge2sasag
      Member
      • Apr 2013
      • 43

      #3
      Hi GenoMax, thanks for your reply.

      Both files were trimmed together with the option paired-end library... that's why I don't know the reason of disconcordant reads....

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Have you examined the BAM files using a genome browser (e.g. IGV) to see if the two reads are mapping within expected distance (it appears that they perhaps are not, if the concordance message is to be believed).

        Comment

        • ge2sasag
          Member
          • Apr 2013
          • 43

          #5
          Discover the magic of the internet at Imgur, a community powered entertainment destination. Lift your spirits with funny jokes, trending memes, entertaining gifs, inspiring stories, viral videos, and so much more from users.


          this is an example of how the reads look like

          Comment

          • ge2sasag
            Member
            • Apr 2013
            • 43

            #6
            Any idea??

            Comment

            • GenoMax
              Senior Member
              • Feb 2008
              • 7142

              #7
              It is difficult to know from that image since unlike IGV the two reads that belong to a fragment are not identifiable (IGV can display them as pairs). Default values for -I and -X are 0 and 500. Did you change either of them?

              If you have the read files available locally can you check the insert sizes using BBMap program (it is pure Java and will run on PC/Mac)? See this answer to get the commands. You can add reads=1000000 to the command to use 1 million reads (instead of the full dataset).

              Comment

              • ge2sasag
                Member
                • Apr 2013
                • 43

                #8
                for -I, I used 0, for -X I tried 500 and 1000 with no difference.

                Comment

                • ge2sasag
                  Member
                  • Apr 2013
                  • 43

                  #9
                  This is an example of the first reads from TrimGalore output files 1 and 2 (as shown in Galaxy with the "eye" button):

                  File1:

                  @HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 1:N:0:CAGATC CCCANGATCTGTTCCACAGGAGATAAGCAGATCTTACTCCAGAGACCACTG + BB<f#0<b<fbffbfbbbff<b&lt;<ffffiibfffbf<fbbb<fb<ffiff7< p="">

                  @HWI-ST1018:141:H0HVBADXX:1:1101:1134:1970 1:N:0:CAGATC TGGCNTATGAAGTTCAGTGTTCTTTGGCTTGTTAGTCAGAACTGTTGC + BBBF#0BFFFFFFIFFFIIIIIFIIIFFIIIIIIIIIIIIIIFIIIII

                  @HWI-ST1018:141:H0HVBADXX:1:1101:1153:1984 1:N:0:CAGATC ACCTCTGTCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGT + BBBFFF<0B<b<fbfb&lt;0<ffb0fbb70bbbb0bff&lt;<bb<bfbfbfbb< p="">

                  File2:

                  @HWI-ST1018:141:H0HVBADXX:2:1101:1184:1971 1:N:0:CAGATC CTGATCAGAGGAGGAACATGACTAATCTATGGGCAGCCTACACTGAAGGC + BBBFFFFFFFFFFIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIIIIIII

                  @HWI-ST1018:141:H0HVBADXX:2:1101:1423:1966 1:N:0:CAGATC AATGGGTAGGTAAATGGATGGCTGGGTGAATGGATGGGTGGGTGGATTGGC + BBBFFFFFFFFFFIIIIFFIIFIIIIFFFIIIIFFFIIBFFIBFFFIIII7

                  @HWI-ST1018:141:H0HVBADXX:2:1101:1596:1990 1:N:0:CAGATC GATATCTTTTGTTTGTAGATATCTTTTCTAAGGCCCACATTCAGTGCAGAC + BBBFFBFFFFBBBBF<bfiiiiiiiiiiiifiifffiifiiiff0b<f7ff< p="">

                  Now I realize... it seems that after TrimGalore, the reads are not sorted?? TrimGalore is supposed to sort the reads right?

                  Comment

                  • GenoMax
                    Senior Member
                    • Feb 2008
                    • 7142

                    #10
                    Something does not appear to be right. Did you get two output files (R1 trimmed and R2 trimmed) from the two (R1/R2 original) that you used as input for the trimming? Your file 2 does not contain any reads with 2 as read identifier (see example below).

                    e.g. @HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 1:N:0:CAGATC in File 1
                    should have a corresponding
                    @HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 2:N:0:CAGATC, in File 2. (note the bold read numbers).

                    Your example has no reads that show that property, if you are posting data from R1/R2 files for the same sample.

                    This is likely the reason why you are seeing discordant alignments.

                    You can either re-trim the data using a paired-end data aware aligner (you could use bbduk.sh from BBMap suite) or use "repair.sh" from BBMap to re-pair the trimmed files. Unfortunately you would need to do this outside galaxy.
                    Last edited by GenoMax; 07-13-2017, 10:19 AM.

                    Comment

                    • ge2sasag
                      Member
                      • Apr 2013
                      • 43

                      #11
                      But in file 2, there are no reads with 2:N:0 tag, the number 2 is here (in bold):

                      @HWI-ST1018:141:H0HVBADXX:2:1101:1184:1971 1:N:0:CAGATC CTGATCAGAGGAGGAACATGACTAATCTATGGGCAGCCTACACTGAAGGC + BBBFFFFFFFFFFIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIIIIIII

                      I already used a paired-end data aware aligner, Trim Galore, and those examples are the beginning of the two output files. Is it possible that the reads from the original FASTQ files are in the same orientation instead of -fr?

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142

                        #12
                        The 2 that you highlight in your example above refers to the lane number where this sample ran on a flowcell (see this).

                        Do you actually have paired-end data? i.e. Paired-end data should have two files per sample that have names like Sample_R1.fq.gz and Sample_R2.fq.gz. Can you post the names of your original files?

                        The two examples you posted above seem to contain data from one sample (or two independent samples) that ran in lanes 1 and 2. They are not paired-end data files.
                        Last edited by GenoMax; 07-13-2017, 10:34 AM.

                        Comment

                        • ge2sasag
                          Member
                          • Apr 2013
                          • 43

                          #13
                          aha! ok thanks for the clarification!

                          an example of original fastq file names:

                          INPUT_1_130506_BH0HVBADXX_P382_108_index8_1.fastq
                          INPUT_2_130506_BH0HVBADXX_P382_108_index8_1.fastq

                          Comment

                          • GenoMax
                            Senior Member
                            • Feb 2008
                            • 7142

                            #14
                            I don't think these are paired-end data. These appear to be single-end data files for two samples (INPUT_1 and INPUT_2) and should be aligned independently of each other.

                            Comment

                            • ge2sasag
                              Member
                              • Apr 2013
                              • 43

                              #15
                              Maybe that's the reason of the strange things.... I was confused by the numbers 1 and 2 in the sample name!! Thanks a lot for your help and time!!!

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Today, 10:13 AM
                              0 responses
                              10 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-31-2026, 02:55 AM
                              0 responses
                              23 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-24-2026, 12:17 PM
                              0 responses
                              19 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-23-2026, 11:41 AM
                              0 responses
                              17 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...