[rcorbett]

I am getting the same error:
This is with version tophat-1.0.13. Has anyone coded a fix for this?

@2065
AGGCCGCTCCGGGCGCTGGACGTTGGGCTCCTGGCGAACCTCTCGGCGCTGGAGACTGGATATAACACAAC
+SOLEXA3_1:1:1:22:173/2
EDHEGHHCDHHGHHHHHCG/HHHHGEDHH=HHHGGHF<?HHHEGHDCHHADB#6@=#8AAG:@@E=1#@>#
Saw ASCII character 10 but expected 33-based Phred qual.
terminate called after throwing an instance of 'int'
Aborted

[rcorbett]

I tried a workaround of changing all the "." characters in the sequence to "N" with awk:

awk '{if ( (NR-2)%4==0) {gsub(/\./,"N",$0); print $0} else { print $0}}'

Which gets me through prep_reads without any errors. Can anyone comment on if this is a safe workaround?

[bzhang]

I tried a workaround of changing all the "." characters in the sequence to "N" with awk:

awk '{if ( (NR-2)%4==0) {gsub(/\./,"N",$0); print $0} else { print $0}}'

Which gets me through prep_reads without any errors. Can anyone comment on if this is a safe workaround?

I did the same conversion and was able to run the downstream analysis with cufflinks and the result seems to be fine. I think this is a safe workaround as 'N' is a legitimate character in the fasta sequence and I assume the alignment software (bowtie) treats it intelligently.

[maubp]

I've added [ code ] tags round your FASTQ example for clarity - otherwise the forum messes things up.

I am getting the same error:
This is with version tophat-1.0.13. Has anyone coded a fix for this?

@2065
AGGCCGCTCCGGGCGCTGGACGTTGGGCTCCTGGCGAACCTCTCGGCGCTGGAGACTGGATATAACACAAC
+SOLEXA3_1:1:1:22:173/2
EDHEGHHCDHHGHHHHHCG/HHHHGEDHH=HHHGGHF<?HHHEGHDCHHADB#6@=#8AAG:@@E=1#@>#

Saw ASCII character 10 but expected 33-based Phred qual.
terminate called after throwing an instance of 'int'
Aborted

The (optional repeated) identifier on the + line doesn't match the (mandatory) identifier on the @ line. Assuming nothing went wrong in the cut and paste into the forum, it looks like something is very wrong with your FASTQ file. This may be what is upsetting tophat.

[clariet]

Hi, Cole_Trapnell

Does current version of Tophat support SOLiD data? Thanks

Clariet

Thanks for the heads up. We'll add the bug to our tracker and address it in the next release. Others are likely to have this problem.

[Cole Trapnell]

I've added [ code ] tags round your FASTQ example for clarity - otherwise the forum messes things up.

The (optional repeated) identifier on the + line doesn't match the (mandatory) identifier on the @ line. Assuming nothing went wrong in the cut and paste into the forum, it looks like something is very wrong with your FASTQ file. This may be what is upsetting tophat.

Actually, the mismatch between the "@" and "+" names should be fine, at least within TopHat. In fact, the program exploits this feature of FASTQ to make analyzing paired and long reads much easier. One of the first things TopHat does is "rename" the user's reads with increasing integer IDs, moving their true names from the "@" field down to the "+" field and rewriting the FASTQ files to a temporary file. Mate pairs from the same fragment get the same ID, making intermediate results for them them much easier to match back up later on.

[Cole Trapnell]

Hi, Cole_Trapnell

Does current version of Tophat support SOLiD data? Thanks

Clariet

Currently, no.

[clariet]

Thank you. Are you planning to add this sometime soon? My colleague has very good comments on TopHat and I am very much looking forward to using this tool for SOLiD data, which I have access only. Bowtie, as far as I know, supports SOLiD.

Currently, no.

[RSK]

Empty (almost) junctions.bed file...

I have a related question.
I mapped Illumina 100nt reads using TopHat in default mode.
The resulting junctions.bed has only a single line, "track name=junctions description="TopHat junctions"."
When I used the resulting accepted_hits.sam file to identify transcripts using Cufflinks, the resulting transcripts.gtf has about 190,000 transcripts. But, all the transcripts have only one exon!
All these things together makes me wonder if there was a problem with mapping across intronic regions in the TopHat/Bowtie stage, with these data.

Please let me know if anyone has any idea on how to deal with this issue. Also please let me know if my description needs any clarifications.

Thanks!
-RSK

[maximilianh]

Same here

I did the same conversion and was able to run the downstream analysis with cufflinks and the result seems to be fine. I think this is a safe workaround as 'N' is a legitimate character in the fasta sequence and I assume the alignment software (bowtie) treats it intelligently.

I have used "maq sol2sanger" to convert my fastq file.

I had the same problem and applied that little gawk script (thanks guys, really saved me wasting hours).

And Cole: I am using tophat 1.0.14.

[thinkRNA]

I have used "maq sol2sanger" to convert my fastq file.

I had the same problem and applied that little gawk script (thanks guys, really saved me wasting hours).

And Cole: I am using tophat 1.0.14.

Where did you get version 1.0.14? I thought the latest that was out was TopHat 1.0.13 (BETA) release 2/5/2010

[maximilianh]

TopHat 1.0.14

Where did you get version 1.0.14? I thought the latest that was out was TopHat 1.0.13 (BETA) release 2/5/2010

From here: http://tophat.cbcb.umd.edu/index.html

[maximilianh]

If this is Illumina data, were your reads processed with pipeline v1.3 or later? If so, you have to include the --solexa-quals option in your TopHat run.

I've had the same problem when pre-processed the illumina file first with maq sol2sanger. I am using tophat 1.4 now and AM NOT PREPROCESSING anymore and it works!! Just use the .txt file

Max

[sanwen]

I did not understand what this paragraph mean in the Manual, i am not a native english speaker.
"Arguments:
<ebwt_base> The basename of the index to be searched. The basename is the name of any of the five index files up to but not including the first period. bowtie first looks in the current directory for the index files, then looks in the indexes subdirectory under the directory where the currently-running bowtie executable is located, then looks in the directory specified in the BOWTIE_INDEXES environment variable. "
what does this paragraph? For example, i have bowtie index (dog.fa, dog.fa.1.ebwt, dog.fa.2.ebwt and so on) in director /home/index, when i try to run the software, i type "tophat -r 200 /home/index/dog.fa test.fq
but it always show :
checking for Bowtie index files
checking for reference FASTA file
Warning:Could not find FASTA file /home/indexdog.fa.fa
Reconstituting reference FASTA file from Bowtie index

What is the problem?

[raela]

You would use dog, not dog.fa. It adds the .fa for you when it search.es