Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Jandropu
    Junior Member
    • Apr 2013
    • 3

    #1

    UCSC Encode files issue with MAPQ and Flags

    Hi,

    I have been reading Seqanswers for quite some time, but this my first question.

    Does someone has experience with BAM files from UCSC-encode project? I am interested in a small RNASeq dataset from CSHL and I found some issues in the BAM files hosted at UCSC.

    It seems there are multiple alignments (2) for the same read, but not flagged as primary and secondary. In the first example bellow, same read name appears twice with same flag (0) and same alignment score (254). In the second example the duplicated read name is the reverse complement sequence.

    Code:
    # Number of multiple alignments in a sample
    samtools view ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlShortRnaSeq//wgEncodeCshlShortRnaSeqA549CellShorttotalTapAlnRep1.bam | head -n 10000| awk '{print $1}' | sort | uniq -c | awk '{print $1}' | sort | uniq -c
       9958 1
         21 2
    
    # Example 1
    view ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlShortRnaSeq/wgEncodeCshlShortRnaSeqA549CellShorttotalTapAlnRep1.bam | grep -m 2 'TUPAC_0038:7:110:15042:19226#0/1'
    TUPAC_0038:7:110:15042:19226#0/1        0       chr1    45243516        254     34M2S   *       0       0       CTCGTGATGAAAACTTTGTCCAGTTCTGCTACTGAA Ycacc\KW_RSLWSVMTTYT]a\a_`_KXK\Z\RQ_
    TUPAC_0038:7:110:15042:19226#0/1        0       chr1    45244067        254     3S31M2S *       0       0       CTCGTGATGAAAACTTTGTCCAGTTCTGCTACTGAA Ycacc\KW_RSLWSVMTTYT]a\a_`_KXK\Z\RQ_
    
    # Example 2
    samtools view ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlShortRnaSeq/wgEncodeCshlShortRnaSeqA549CellShorttotalTapAlnRep1.bam | grep -m 2 'TUPAC_0038:7:88:9054:14403#0/1'
    TUPAC_0038:7:88:9054:14403#0/1  16      chr1    234792  246     18S18M  *       0       0       CCGATCTTTTTTTTTTTCTAAGGACATCCTAAAGGA    ghfeecchhhhfhhhhhhghhhhhhhhhhhhhhhhh
    TUPAC_0038:7:88:9054:14403#0/1  0       chr1    464897  246     18M18S  *       0       0       TCCTTTAGGATGTCCTTAGAAAAAAAAAAAGATCGG    hhhhhhhhhhhhhhhhhghhhhhhfhhhhcceefhg

    Related to it, the alignment scores are also different from what I have normally seen in BAM files. It ranges from 246 to 255:

    Code:
    samtools view ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlShortRnaSeq/wgEncodeCshlShortRnaSeqA549CellShorttotalTapAlnRep1.bam | head -n 10000 | awk '{print $5}' | sort | uniq -c
         13 246
          5 247
        149 248
         11 249
         19 250
         26 251
         93 252
       9587 253
         77 254
         20 255

    Is this normal? Am I missing something? It seems to happen only for a small percentage of reads. Would you just ignore those with multiple alignments for further analysis? If so, how would you filter them out?

    Thanks!!

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Today, 07:41 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
25 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
38 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
25 views
0 reactions
Last Post SEQadmin2  
Working...