Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • stubrown
    Junior Member
    • Nov 2008
    • 4

    #1

    Need workflow from SRA to BreakDancer

    I am flummoxed by "fastq" formats. My goal for the moment is to test out BreakDancer to find translocations at low coverage. I don't have our own data yet, so want to use data from SRA. I have downloaded a paired-end data set (two 'fastq' files called SRR031156_1.fastq and SRR031156_2.fastq) from SRA but I cant get the SRA file format to be accepted by anything.


    @SRR031156.3 HWI-EAS367_fcID30810AAXXr1:6:1:1564:603 length=31
    GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
    +SRR031156.3 HWI-EAS367_fcID30810AAXXr1:6:1:1564:603 length=31
    <<<<<<<<<<<<<<<<<<<<<<4<<<<<<<<
    @SRR031156.4 HWI-EAS367_fcID30810AAXXr1:6:1:1183:938 length=31
    GATCGGAAGAGCGGTTCAGCAGGAATGCCGA
    +SRR031156.4 HWI-EAS367_fcID30810AAXXr1:6:1:1183:938 length=31
    <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<


    My first effort is to align these nice fastq files with BWA, but I get a segmentation fault. I have checked some other threads on this forum, and it seems clear that the BWA segfault is due to problems with fastq format. This is just bad. The most popular aligner should work with the official standard file archive format in the public data repository.

    [genomes@hactar BreakDancer]$ ./bwa-0.5.8a/bwa aln Mouse_mm9_fa/MUS SRX014041/SRR031156_1.fastq > MUS_aln.sai
    [bwa_aln] 17bp reads: max_diff = 2
    [bwa_aln] 38bp reads: max_diff = 3
    [bwa_aln] 64bp reads: max_diff = 4
    [bwa_aln] 93bp reads: max_diff = 5
    [bwa_aln] 124bp reads: max_diff = 6
    [bwa_aln] 157bp reads: max_diff = 7
    [bwa_aln] 190bp reads: max_diff = 8
    [bwa_aln] 225bp reads: max_diff = 9
    [bwa_aln_core] calculate SA coordinate... Segmentation fault


    My second effort is to try to convert to SAM or BAM format using FastqToSam.jar from the SAMTOOLS/Picard toolkit. This fails because there is not a /1 or /2 at the end of the header line for each read.

    I really do not want to write some new Perl script for such an obvious task. There must be a well validated workflow out there from SRA to BWA.

    ... And from BWA output to BreakDancer (to avoid my next post when that also turns out to be problematic)
  • nickloman
    Senior Member
    • Jul 2009
    • 355

    #2
    Isn't BWA called as follows:

    bwa aln <database> <FASTQ file>

    a la



    Edit: Actually I can see you did that already. Did you run bwa index on the mouse database first?

    Comment

    • raela
      Member
      • Apr 2010
      • 39

      #3
      Also, if you did index it, are you sure you indexed correctly? I had the same issue until I made another index for the genome, then it ran fine. If you want to test if it's the reads, only grab one chromosome, index it, and see if it aligns then.

      Comment

      • stubrown
        Junior Member
        • Nov 2008
        • 4

        #4
        OK, that was a very helpful idea to work with the index of just one chromosome. That worked fine. So I guess my problem is really about how do I index an entire genome of chromosome *.fa files? (i.e. the Mouse mm9 genome from UCSC); or once indexed, how do I point to all of them as a database for the 'bwa aln' command?

        I did this by running the 'bwa index' command inside of a 'foreach' loop for each of my *.fa files. I got a lot of index files (.pac, .rpac, etc), but perhaps this is the source of my segmentation fault error.

        Comment

        • raela
          Member
          • Apr 2010
          • 39

          #5
          That would most likely be the issue! You need to combine the chromosomes into one file. On a *nix machine, say each is named chr##.fa (I know it's this way for the horse.. chr1, chr2, chr3, ... chrX) - you would do
          cat chr*.fa > genome.fa
          This tells it to put the contents of all files in the new file genome.fa. Then you index, but, you probably want to use -a bwtsw.. I believe not including that flag was my error. So, you'd do
          bwa index -p prefix -a bwtsw genome.fa

          Comment

          • history_of_robots
            Junior Member
            • May 2011
            • 9

            #6
            Originally posted by raela View Post
            That would most likely be the issue! You need to combine the chromosomes into one file. On a *nix machine, say each is named chr##.fa (I know it's this way for the horse.. chr1, chr2, chr3, ... chrX) - you would do
            cat chr*.fa > genome.fa
            This tells it to put the contents of all files in the new file genome.fa. Then you index, but, you probably want to use -a bwtsw.. I believe not including that flag was my error. So, you'd do
            bwa index -p prefix -a bwtsw genome.fa
            You are suggesting to use '-a bwtsw'. On BWA manual (http://bio-bwa.sourceforge.net/bwa.shtml) it says: "BWA-SW can also be used to align ~100bp reads, but it is slower than the short-read algorithm." and "On low-error short queries, BWA-SW is slower and less accurate than the first algorithm [IS], but on long queries, it is better". So it is '-a is' that is seemed to be required for BWA indexing a genome for subsequent short read alignment. However, in the same manual page it says: 'IS is moderately fast, but does not work with database larger than 2GB'. A complete genome can be larger than that (for example mm9.fa is 2.5GB). So I am wondering if chromosomes should be indexed separately. Unfortunately, it seems that in this case BWA will have to be run on each chromosome separately it seems. Or is there another way to use IS on the whole genome?
            "Let’s start with the three fundamental Rules of Robotics...."

            Comment

            • raela
              Member
              • Apr 2010
              • 39

              #7
              Originally posted by history_of_robots View Post
              You are suggesting to use '-a bwtsw'. On BWA manual (http://bio-bwa.sourceforge.net/bwa.shtml) it says: "BWA-SW can also be used to align ~100bp reads, but it is slower than the short-read algorithm." and "On low-error short queries, BWA-SW is slower and less accurate than the first algorithm [IS], but on long queries, it is better". So it is '-a is' that is seemed to be required for BWA indexing a genome for subsequent short read alignment. However, in the same manual page it says: 'IS is moderately fast, but does not work with database larger than 2GB'. A complete genome can be larger than that (for example mm9.fa is 2.5GB). So I am wondering if chromosomes should be indexed separately. Unfortunately, it seems that in this case BWA will have to be run on each chromosome separately it seems. Or is there another way to use IS on the whole genome?
              No, what I said is correct - you are thinking of "bwa bwasw" as an alternate to aln + samse/sampe. The -a bwtsw uses the algorithm for indexing a large genome. BWTSW vs. IS has nothing to do with read size - just genome size.

              Comment

              • history_of_robots
                Junior Member
                • May 2011
                • 9

                #8
                Oh cool, you are absolutely right! That's the right option to index a genome for short read alignment. Thanks very much.
                "Let’s start with the three fundamental Rules of Robotics...."

                Comment

                • niti217
                  Member
                  • Dec 2011
                  • 10

                  #9
                  I am having similar problem - any help would be greatly appreciated.

                  I am trying to index Homo_sapiens.GRCh37 ...fa file using the command

                  bwa index -p myGenome -a bwtsw /directory/myGenome.fa

                  but it keeps giving me the following error

                  [bwa_index] Pack FASTA... 56.76 sec
                  [bwa_index] Reverse the packed sequence... Segmentation fault

                  Can someone please help me with possible suggestion to fix this. Thank you.

                  Comment

                  • houkto
                    Junior Member
                    • Sep 2011
                    • 5

                    #10
                    Originally posted by niti217 View Post
                    I am having similar problem - any help would be greatly appreciated.

                    I am trying to index Homo_sapiens.GRCh37 ...fa file using the command

                    bwa index -p myGenome -a bwtsw /directory/myGenome.fa

                    but it keeps giving me the following error

                    [bwa_index] Pack FASTA... 56.76 sec
                    [bwa_index] Reverse the packed sequence... Segmentation fault

                    Can someone please help me with possible suggestion to fix this. Thank you.
                    I saw a similar error in another forum http://biostar.stackexchange.com/que...entation-fault it turns out to be a hardware issue i.e memory less than 2G


                    N.B happy new year

                    Comment

                    • niti217
                      Member
                      • Dec 2011
                      • 10

                      #11
                      Originally posted by houkto View Post
                      I saw a similar error in another forum http://biostar.stackexchange.com/que...entation-fault it turns out to be a hardware issue i.e memory less than 2G


                      N.B happy new year
                      Thanks so much for your help. I really appreciate it.

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Yesterday, 10:13 AM
                      0 responses
                      14 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      28 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      21 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-23-2026, 11:41 AM
                      0 responses
                      21 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...