Non-specific bands when using Illumina adapters?

[lavamartin]

Hi all,
I am new to the Illumina system. When I did the PCR and ran the gel using normal sets of primers. Everything is nice and clean. However, when I used the primers with Illumina adapters. I got non-specific bands and smear. Can someone help me please?
PCR conditions are the same for both with/without the adapters.

16S primers: 515'F/926r

GTGBCAGCMGCCGCGGTAA
CCGYCAATTYMTTTRAGTTT

16S primers with adapters:

5'[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTGBCAGCMGCCGCGGTAA-3'
5’[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGYCAATTYMTTTRAGTTT-3'

16S PCR condition:

95 C - 5 min
35 cycles of 95 C - 30 sec/ 55.5 C - 30 sec / 72 C - 30 sec
72 C - 10 min

18S primers: Euk1391f/EukBr

GTACACACCGCCCGTC
TGATCCTTCTGCAGGTTCACCTAC

with adapters:
5’[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTACACACCGCCCGTC-3'
5’[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]TGATCCTTCTGCAGGTTCACCTAC-3'

18S PCR condition:

94C - 3 min
35 cycles of 94C - 45 sec/ 57C - 60 sec/ 72C - 90 sec
72C - 10 min

These are all environmental DNA which the original extracted DNA concentration are very low.

Thank you!
Kitty

[t.m.wasiak]

Hi Kitty,

This is typhical for Illumina primers witha adapters. This method works only for a highly good DNA template. I suggest you use the protocol Kircher&Meyer (https://www.ncbi.nlm.nih.gov/pubmed/20516186). For metagenomics we're using primers (V3 region of 16S rRNA):
F: CCTACGGGRSGCAGCAG
R: ACCGCGGCKGCTGGC
Polymerase KAPA HiFi, reaction with addition of 3% DMSO (we work on ancient DNA, if you have modern DNA samples, DMSO supplement is unnecessary but you can try with it).
PCR protocol:
95C - 2min
29 cycles (when we made more cycles we got bands in blak sample)
98C - 20 sec
54C - 20 sec
72C - 15 sec
72C - 5 min
4C -

Next stepas are in Kircher&Mayer protocol:

Blut end by - NewEngland Quik Blunting Kit
Adapter ligation - NewEngland Quik Ligation Kit
Adapter fill-in - NewEngland Bst polymerase
Indexing raction - KAPA HiFi

If you have aditional question fell free.

All the best
Tomek