Tweet
Hello everyone,
I have encountered a rather strange contamination in our DNA libraries and would be thankful for help in finding the source, the proper way to trim it and advice on how to avoid it in the future.
Background:
Our plant sample DNA are prepared in-house following a modified KAPA protocol with P5-P7 indexes (that we mix ourselves; corresponsing to Illumina adapters) and AMPure beads. We use dual-indexing attached in a PCR step (rather short with 8 cycles). Our indexes are 8bp long corresponding to TruSeq. Prior to pooling all samples are size-selected to remove fragments <150bp, hence supposedly removing all traces of adapter dimer. Samples were pooled and sent to sequencing center where they were sequenced on a HiSeqV4 PE125. A spike-in from another user was present.
According to the fastqc report, on read1 the full library seems to include about 6 million reads of an unknown source, not similar to any index that we used, not to the index reported from the other user nor to published DNA sequences from Illumina, but it does 'look like' an artifact:
ACCTTATTCACGCCTAAAAAGTAGACTGACTGTGGGGTGGTCGTGTTTTT
It doesn't blast to any known plant sequences (seems to blast to some human sequence but with a low match, could be adapter someone else left in...). No contamination is present on read2. See attached fastqc screenshot.
The truly inexplicable part is that after successfully demultiplexing (using deML) those 'contaminant' reads are present in all separate sample files in similar numbers
(example fastqc report attached), comprising 20% of the reads for some samples! I cannot understand this behavior and cannot figure out whether I'm seeing a PCR artifact, another user's index or something else.
In addition, trimming those reads using Trimmomatic gave bad results - I added the contaminant sequence to Trimmomatic's adapter file and lost almost 40% of the reads for many samples.
Any hint to direct me in bioinformatic forensics would be very much welcome.
I have encountered a rather strange contamination in our DNA libraries and would be thankful for help in finding the source, the proper way to trim it and advice on how to avoid it in the future.
Background:
Our plant sample DNA are prepared in-house following a modified KAPA protocol with P5-P7 indexes (that we mix ourselves; corresponsing to Illumina adapters) and AMPure beads. We use dual-indexing attached in a PCR step (rather short with 8 cycles). Our indexes are 8bp long corresponding to TruSeq. Prior to pooling all samples are size-selected to remove fragments <150bp, hence supposedly removing all traces of adapter dimer. Samples were pooled and sent to sequencing center where they were sequenced on a HiSeqV4 PE125. A spike-in from another user was present.
According to the fastqc report, on read1 the full library seems to include about 6 million reads of an unknown source, not similar to any index that we used, not to the index reported from the other user nor to published DNA sequences from Illumina, but it does 'look like' an artifact:
ACCTTATTCACGCCTAAAAAGTAGACTGACTGTGGGGTGGTCGTGTTTTT
It doesn't blast to any known plant sequences (seems to blast to some human sequence but with a low match, could be adapter someone else left in...). No contamination is present on read2. See attached fastqc screenshot.
The truly inexplicable part is that after successfully demultiplexing (using deML) those 'contaminant' reads are present in all separate sample files in similar numbers
(example fastqc report attached), comprising 20% of the reads for some samples! I cannot understand this behavior and cannot figure out whether I'm seeing a PCR artifact, another user's index or something else.In addition, trimming those reads using Trimmomatic gave bad results - I added the contaminant sequence to Trimmomatic's adapter file and lost almost 40% of the reads for many samples.
Any hint to direct me in bioinformatic forensics would be very much welcome.
Comment