Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • bwubb
    Member
    • Jan 2012
    • 61

    #631
    Originally posted by GenoMax View Post
    BBMap is one of the aligners that uses the full header present in your fasta file when creating the index and passes it along to alignment file. If there are spaces in the header name they are written to alignment. Some downstream programs have a problem with this.

    You can use the option "trd=t" to truncate the fasta header names after the first space in the name. There is an option for reformat.sh that can do this after the fact for aligned data. I can look this up later if you don't find it.
    Thank you. I had found this too sometime after my post and before yours, but its really great to get a helpful reply!

    Comment

    • Gopo
      Member
      • Nov 2013
      • 41

      #632
      Hi Brian,

      Does bbmap callvariants.sh ignore duplicates marked by picard MarkDuplicates by default (or is there an option to ignore duplicates) or do duplicates have to be deleted?

      Best,
      Gopo

      Comment

      • darthsequencer
        Member
        • Feb 2012
        • 35

        #633
        Hi Brian,
        I'm using trimrname=t from reformat.sh on a sam file. It looks like it trims the ref names correctly on the alignment lines, but not in header lines (the ones that start with @).

        Comment

        • Meyana
          Member
          • Sep 2017
          • 40

          #634
          Dear Brian,

          I am using bbmap for mapping and callvariants.sh for variant calling on PE Illumina reads.
          I am comparing two mice strains. I am therefore downsampling my .sam files to have the same number of mapped reads going into the alignment.

          When I input the original file containing ~680k mapped PE reads I get 2283 variants. When I run the down sampled file containing ~200k mapped PE reads I get 3375 variants.

          I would expect to get a lower number of variants when I put in less reads. Could you explain this to me? I am clearly missing something that might be important for my analysis

          (I am using the exact same criteria for variant calling and filtering for the two samples)

          Comment

          • gaohanlisa
            Junior Member
            • Jul 2018
            • 1

            #635
            I am trying to run BBmap on the cluster, but got the error below. Can anyone help me to solve the error?
            Thanks,
            [hgx080@quser10 DNA_all]$ /home/hgx080/bbmap/bbmap.sh ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom
            java -Djava.library.path=/home/hgx080/bbmap/jni/ -ea -Xmx100g -cp /home/hgx080/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom
            Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa, in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa, out=RNA-Ac-1_S7_filter.test.sam, minid=0.95, ambig=random, reads=100000, -Xmx100g, -eoom]
            Version 38.11

            Choosing a site randomly for ambiguous mappings.
            Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.908
            NOTE: Ignoring reference file because it already appears to have been processed.
            NOTE: If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
            Max reads: 100000
            Set genome to 1

            Exception in thread "Thread-0" java.lang.RuntimeException: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream
            at align2.ChromLoadThread.run(ChromLoadThread.java:79)
            Caused by: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream
            at fileIO.ReadWrite.readObject(ReadWrite.java:806)
            at fileIO.ReadWrite.read(ReadWrite.java:1246)
            at dna.ChromosomeArray.read(ChromosomeArray.java:65)
            at align2.ChromLoadThread.run(ChromLoadThread.java:76)
            Caused by: java.io.EOFException: Unexpected end of ZLIB input stream
            at java.util.zip.InflaterInputStream.fill(InflaterInputStream.java:240)
            at java.util.zip.InflaterInputStream.read(InflaterInputStream.java:158)
            at java.util.zip.GZIPInputStream.read(GZIPInputStream.java:117)
            at java.io.ObjectInputStream$PeekInputStream.read(ObjectInputStream.java:2620)
            at java.io.ObjectInputStream$BlockDataInputStream.read(ObjectInputStream.java:3031)
            at java.io.ObjectInputStream$BlockDataInputStream.readFully(ObjectInputStream.java:3061)
            at java.io.ObjectInputStream.readArray(ObjectInputStream.java:1914)
            at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1529)
            at java.io.ObjectInputStream.defaultReadFields(ObjectInputStream.java:2245)
            at java.io.ObjectInputStream.readSerialData(ObjectInputStream.java:2169)
            at java.io.ObjectInputStream.readOrdinaryObject(ObjectInputStream.java:2027)
            at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1535)
            at java.io.ObjectInputStream.readObject(ObjectInputStream.java:422)
            at fileIO.ReadWrite.readObject(ReadWrite.java:802)
            ... 3 more

            Comment

            • StephCarr
              Junior Member
              • Jul 2018
              • 2

              #636
              Hello! Thanks for all of the wonderful bbmap scripts. Today I was was trying to use bbfakereads.sh but the script can not locate or open the jgi/FakeReads file. Any thoughts? I noticed a Fakereads files in the current/jgi directory. Do you think the path in the script is incorrect?

              Thanks for your time and help!

              bbfakereads.sh in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150
              java -ea -Xmx600m -cp /media/bioinformaticprograms/BBMap/sh/current/ jgi.FakeReads in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150
              Error: Could not find or load main class jgi.FakeReads

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #637
                Is your bbmap installed correctly? Have you moved any files around? I am able to run "bbfakereads.sh" and generate fastq and fasta files without a problem.

                Comment

                • StephCarr
                  Junior Member
                  • Jul 2018
                  • 2

                  #638
                  You're right. It wasn't downloaded correctly. At first I used git to download the bbmap package. But when I just downloaded with wget from https://sourceforge.net/projects/bbm...p_38.12.tar.gz everything was organized correctly.

                  Thanks for the help.

                  Comment

                  • olgabot
                    Junior Member
                    • Apr 2014
                    • 1

                    #639
                    Add hg19 masked reference to distribution

                    Hello,
                    I'm using BBTools via bioconda and the corresponding quay.io docker container. The image has the necessary resources, e.g. the adapters fasta file:

                    Code:
                    (base) 
                     Wed 25 Jul - 17:10  ~/code/tick-genome/reflow   origin ☊ master 9☀ 1● 
                      docker run -it -v $PWD:/data quay.io/biocontainers/bbmap:38.06--2 bash
                    bash-4.2# find . -name adapters.fa
                    ./usr/local/opt/bbmap-38.06/resources/adapters.fa
                    bash-4.2# cd ./usr/local/opt/bbmap-38.06/resources
                    bash-4.2# ll
                    bash: ll: command not found
                    bash-4.2# ls 
                    adapters.fa                          blacklist_silva_species_500.sketch   lambda.fa.gz                         nextera_LMP_linker.fa.gz             primes.txt.gz                        sequencing_artifacts.fa.gz
                    adapters_no_transposase.fa.gz        contents.txt                         lfpe.linker.fa.gz                    pJET1.2.fa                           remote_files.txt                     short.fa
                    blacklist_img_species_300.sketch     crelox.fa.gz                         mtst.fa                              phix174_ill.ref.fa.gz                remote_files_old.txt                 truseq.fa.gz
                    blacklist_nt_species_1000.sketch     favicon.ico                          nextera.fa.gz                        phix_adapters.fa.gz                  sample1.fq.gz                        truseq_rna.fa.gz
                    blacklist_refseq_species_250.sketch  kapatags.L40.fa                      nextera_LMP_adapter.fa.gz            polyA.fa.gz                          sample2.fq.gz
                    However, the removehuman.sh script uses a hardcoded path for the masked human genome posted in the RemoveHuman thread.


                    Code:
                    	local CMD="java -Djava.library.path=$NATIVELIBDIR $EA $z -cp $CP align2.BBMap minratio=0.9 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/global/projectb/sandbox/gaag/bbtools/hg19 pigz unpigz zl=6 qtrim=r trimq=10 untrim idtag usemodulo printunmappedcount usejni ztd=2 kfilter=25 maxsites=1 k=14 $@
                    Can the masked genome be included in the distribution?

                    Thank you!
                    Warmest,
                    Olga

                    Comment

                    • sunnycqcn
                      Member
                      • Apr 2013
                      • 17

                      #640
                      Hello Brian,
                      After running mapPacBio.sh, how can I combine the sequence of the same ID?
                      for example I want to combine the sequences as following:
                      m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_2_6
                      m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_3

                      Thanks,
                      Fuyou

                      Comment

                      • JenBarb
                        Member
                        • Oct 2010
                        • 47

                        #641
                        pull out sequences with matching primers

                        Hi Brian,
                        I was wondering if bbmap has a tool that will pull out reads matching a particular primer sequences? I have fastq files with amplicons from 12 different primers in the same file so i want to make subsets of the reads having specific primers of interest from this.

                        i have used your tool for other tasks so i figured I would ask if it also has this capability?

                        Thank you,
                        Jen

                        Comment

                        • HESmith
                          Senior Member
                          • Oct 2009
                          • 512

                          #642
                          @JenBarb see this thread in Biostars.

                          Comment

                          • JenBarb
                            Member
                            • Oct 2010
                            • 47

                            #643
                            Thank you! Love the tool!

                            Comment

                            • Meyana
                              Member
                              • Sep 2017
                              • 40

                              #644
                              Hi,
                              Hoping somebody can help me with this.

                              I used BBMap and now I would like to extract the reads from by .bam file that are split (/chimeric?) ie. reads that indicate a deletion.

                              I tried to use samblaster, but it doesn't recognize any reads as split...
                              (samtools view -h in.bam | samblaster -a -s split.sam -o /dev/null)
                              Are the split reads marked differently in BBMap compared to other aligners causing samblaster to fail?

                              IGV shows a good amount of reads with deletions and I can also call deletions using BBTools callvariants.sh - so I know they are in there. I just have a feeling callvariants is calling fewer deletions and with lower coverage than what IGV suggests, so I want to check up on it.

                              Comment

                              • JenBarb
                                Member
                                • Oct 2010
                                • 47

                                #645
                                mkf argument in bbduk.sh (bbmap tool)

                                Hello,
                                I am trying to use the flag mkf (minkmerfraction) and I am getting an error that that argument does not exist.
                                sh /data/barbj/bbmap/bbduk.sh in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
                                java -Djava.library.path=/data/barbj/bbmap/jni/ -ea -Xmx39767m -Xms39767m -cp /data/barbj/bbmap/current/ jgi.BBDukF in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
                                Executing jgi.BBDukF [in=./../Stool_001-01.fastq, outm=v2fstoolfq.fa, literal=CTCAAACTTGGGTAATTAAACC, k=17, mkf=0.8]

                                Exception in thread "main" java.lang.RuntimeException: Unknown parameter mkf=0.8
                                at jgi.BBDukF.<init>(BBDukF.java:402)
                                any ideas why this is not working?

                                Jen

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  Today, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 02:55 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                12 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                12 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...