Have you looked at the in-line help for "splitnextera.sh"? The adapters for Mate Pair libraries are in the "adapters.fa" file so you should be able to trim them as usual (Nextera_LMP_Read1_External_Adapter, Nextera_LMP_Read2_External_Adapter)
Unconfigured Ad
Collapse
X
-
Different Libraries
In SplitNextera guide it states that it it different from LMP. Nextera mate pair is not the same as Mate pair library v2 and also, Mate pair library v2 does not have these LMP adapters you mentioned!Originally posted by GenoMax View PostHave you looked at the in-line help for "splitnextera.sh"? The adapters for Mate Pair libraries are in the "adapters.fa" file so you should be able to trim them as usual (Nextera_LMP_Read1_External_Adapter, Nextera_LMP_Read2_External_Adapter)
From JGI site:
"SplitNextera splits Nextera LMP libraries into subsets based on linker orientation. It is designed strictly for Nextera LMP (long-mate-pair) reads, not for normal libraries using a Nextera kit. Nextera LMP libraries must be split prior to further processing; they are not usable raw. Adapter-trimming should still be done on Nextera LMP libraries prior to splitting."
Mate SamplePrep V2 Documentation:
Comment
-
-
Hi All,
Is it possible to match degenerate sequences like below, trim the sequences and place the degenerate sequences in the fastq header? I am attempting to trim an adapter with the following structure Adapter(21nt)-UMI(16nts)-Adapter(24nt) and place it in the fastq header.
Matching degenerate sequences such as primers:
bbduk.sh in=reads.fq out=matching.fq literal=ACGTTNNNNNGTC copyundefined k=13 mm=f
Thank you for your help!
Comment
-
-
Hi GenoMax,
Thanks for the suggestion! I have used UMI tools which works ok but I am working with long reads with a higher error rate (indel bias) than Illumina reads. Therefore, it is likely that the adapter and UMI will contain indels so the adapter structure may actually look like this, Adapter(19-21nt)-UMI(14-16nts)-Adapter(22-24nt).
Thanks again for your advice!
Comment
-
-
Hi all,
Newcomer to RNA-seq/bbduk/the forum here.. I have a question that's probably really basic, but I have read through the bbduk docs, ctrl+F'ed "maq" and "minavgquality" through all 16 pages of this thread, and tried googling; all to no avail. So here I am.
When using `minavgquality` (`maq`), I'm very puzzled as to how the "average quality" is calculated. I was filtering full-length reads (91bp) by average quality (no trimming involved), and was expecting a very straightforward calculation -- taking the unweighted mean of individual Phred scores across individual bases.
For example, with
@A00325:34:H3FM7DRXX:1:1101:1208:1047 2:N:0:0NACTCTAA
AGTCGTACCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAGAAAAGTAAACTGCGTTTATACCAATGCGTCCGCGGACAGGCGTTT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,,F,,F,F,,,F,,:F,,,FF:F,F,:,,,,,,,FF:F::,,F:::F,:F
There are 25 `,`, 10 `:`, and 56 `F`. Under Illumina 1.8+ encoding scheme, I was expecting something like (25*(44-33)+10*(58-33)+56*(70-33))/(25+10+56)=2597/91=28.5.
I was shocked when this read got filtered with an `maq` of 20.
I looked through some of the source code mentioning `minAvgQuality`. In BBQC.java and RQCFilter2.java, the default `minAvgQuailty` settings seem to be 8 and 5 respectively. This, plus the fact that when I tried `maq=30` all (!) my reads were filtered, made me suspect that bbduk calculates "average quality" differently somehow? Can someone please explain this? (Is this what the "Phred algorithm" alluded to by the bbduk doc is referring to?)
(I read here during my googling attempt that "Calculating average Q (Phred) scores is a bad idea". But it's something that our lab routinely does and I think my PI would want me to do it anyways..)
Command I was using (version 38.25):
bbduk.sh in=raw.fastq out=raw_qual-pass.fastq outm=raw_qual-fail.fastq maq=20 ordered=t
(also tried adding `k=91` since all my reads are 91bp, `qin=33`, `qout=33`; no difference whatsoever)
Thanks!
Comment
-
-
@FlySquirrelFly: It has become difficult to get a hold of Brian (due to his day job responsibilities) but I will flag your post for him to see if he can respond.
I recall from some past discussion that average quality is calculated as a rolling window average and as soon as it drops below your set value it will trim/filter the rest of the read.
You should also consider this:
You may want to explicitly set "qtrim=" if you only want to quality trim. You may also want to useNote - if neither ktrim nor kmask is set, the default behavior is kfilter.
All three are mutually exclusive.Unless you are doing de novo work there is generally no need to filter based on quality. If you have a good reference to align to data as low as Q10 should still be usable.trimq=6 Regions with average quality BELOW this will be trimmed, if qtrim is set to something other than f.Last edited by GenoMax; 10-04-2018, 04:44 AM.
Comment
-
-
@GenoMax:
Thanks for your quick reply and for flagging the post for Brian! Much appreciated.
Indeed, since I did not set ktrim or kmask, kfilter should have been carried out (which is what I intended).
I wanted to filter based on the average quality of the full-length read, so I did not use the options related to and including`qtrim`.
I'm doing two separate analyses. One involves the canonical type of transcriptomic analysis (quantification of gene expression, differential expression analysis, etc). For that, like you said, there's probably no need to filter based on quality. The other involves doing some de novo assembly using the raw reads (for antibody V(D)J receptor). I figured that for the latter it'd probably be nice to have an extra layer of QC.
Comment
-
-
bbduk with bzip2 input file
Hi- Is bzip2 input supported by `bbduk.sh`? When I try it, bbduk seems to hang as below. (It would be good to have support for bzip2)
Thanks!
Code:bbduk.sh in=/scratch/dberaldi/Texas_Biobank/TCRBOA1-N-WEX.read1.fastq.bz2 out=stdout.fq java -Djava.library.path=/home/db291g/test-setup-travis/downloads/bbmap/jni/ -ea -Xmx14666m -Xms14666m -cp /home/db291g/test-setup-travis/downloads/bbmap/current/ jgi.BBDukF in=/scratch/dberaldi/Texas_Biobank/TCRBOA1-N-WEX.read1.fastq.bz2 out=stdout.fq Executing jgi.BBDukF [in=/scratch/dberaldi/Texas_Biobank/TCRBOA1-N-WEX.read1.fastq.bz2, out=stdout.fq] Version 37.98 [in=/scratch/dberaldi/Texas_Biobank/TCRBOA1-N-WEX.read1.fastq.bz2, out=stdout.fq] NOTE: No reference files specified, no trimming mode, no min avg quality, no histograms - read sequences will not be changed. 0.028 seconds. Initial: Memory: max=14737m, free=14276m, used=461m
Comment
-
-
pls help
May i know how to fix this? this the command I entered
$ ./bbduk.sh -Xmx27g in1=~/NGS\ 10273-Raw\ Data\ NO.rep.1/NO.rep.1_1.fq in2=~/NGS\ 10273-Raw\ Data\ NO.rep.1/NO.rep.1_2.fq out1=adapter_trimmed1.fq out2=adapter_trimmed2.fq ref=~/adapters.fa ktrim=r k=23 mink=11 hdist=1 tpe tbo qtrim=rl trimq=10 minlen=36 mag=10 bhist=bhist.txt qhist=qhist.txt gchist=gchist.txt aqhist=aqhist.txt lhist=lhist.txt gcbins=auto
..then this came up
java -ea -Xmx27g -Xms27g -cp /Users/uplb/Documents/AGC/bbmap/current/ jgi.BBDuk -Xmx27g in1=/Users/uplb/NGS 10273-Raw Data NO.rep.1/NO.rep.1_1.fq in2=/Users/uplb/NGS 10273-Raw Data NO.rep.1/NO.rep.1_2.fq out1=adapter_trimmed1.fq out2=adapter_trimmed2.fq ref=/Users/uplb/adapters.fa ktrim=r k=23 mink=11 hdist=1 tpe tbo qtrim=rl trimq=10 minlen=36 mag=10 bhist=bhist.txt qhist=qhist.txt gchist=gchist.txt aqhist=aqhist.txt lhist=lhist.txt gcbins=auto
Executing jgi.BBDuk [-Xmx27g, in1=/Users/uplb/NGS, 10273-Raw, Data, NO.rep.1/NO.rep.1_1.fq, in2=/Users/uplb/NGS, 10273-Raw, Data, NO.rep.1/NO.rep.1_2.fq, out1=adapter_trimmed1.fq, out2=adapter_trimmed2.fq, ref=/Users/uplb/adapters.fa, ktrim=r, k=23, mink=11, hdist=1, tpe, tbo, qtrim=rl, trimq=10, minlen=36, mag=10, bhist=bhist.txt, qhist=qhist.txt, gchist=gchist.txt, aqhist=aqhist.txt, lhist=lhist.txt, gcbins=auto]
Version 38.33
Exception in thread "main" java.lang.RuntimeException: Unknown parameter 10273-Raw
at jgi.BBDuk.<init>(BBDuk.java:513)
at jgi.BBDuk.main(BBDuk.java:76)
is this something to do with the Java? thank you
Comment
-
-
pls help
someone who knows how to fix this?
I entered this command:
$ ./bbduk.sh -Xmx27g in1=~/NGS\ 10273-Raw\ Data\ NO.rep.1/NO.rep.1_1.fq in2=~/NGS\ 10273-Raw\ Data\ NO.rep.1/NO.rep.1_2.fq out1=adapter_trimmed1.fq out2=adapter_trimmed2.fq ref=~/adapters.fa ktrim=r k=23 mink=11 hdist=1 tpe tbo qtrim=rl trimq=10 minlen=36 mag=10 bhist=bhist.txt qhist=qhist.txt gchist=gchist.txt aqhist=aqhist.txt lhist=lhist.txt gcbins=auto
..then this came up
java -ea -Xmx27g -Xms27g -cp /Users/uplb/Documents/AGC/bbmap/current/ jgi.BBDuk -Xmx27g in1=/Users/uplb/NGS 10273-Raw Data NO.rep.1/NO.rep.1_1.fq in2=/Users/uplb/NGS 10273-Raw Data NO.rep.1/NO.rep.1_2.fq out1=adapter_trimmed1.fq out2=adapter_trimmed2.fq ref=/Users/uplb/adapters.fa ktrim=r k=23 mink=11 hdist=1 tpe tbo qtrim=rl trimq=10 minlen=36 mag=10 bhist=bhist.txt qhist=qhist.txt gchist=gchist.txt aqhist=aqhist.txt lhist=lhist.txt gcbins=auto
Executing jgi.BBDuk [-Xmx27g, in1=/Users/uplb/NGS, 10273-Raw, Data, NO.rep.1/NO.rep.1_1.fq, in2=/Users/uplb/NGS, 10273-Raw, Data, NO.rep.1/NO.rep.1_2.fq, out1=adapter_trimmed1.fq, out2=adapter_trimmed2.fq, ref=/Users/uplb/adapters.fa, ktrim=r, k=23, mink=11, hdist=1, tpe, tbo, qtrim=rl, trimq=10, minlen=36, mag=10, bhist=bhist.txt, qhist=qhist.txt, gchist=gchist.txt, aqhist=aqhist.txt, lhist=lhist.txt, gcbins=auto]
Version 38.33
Exception in thread "main" java.lang.RuntimeException: Unknown parameter 10273-Raw
at jgi.BBDuk.<init>(BBDuk.java:513)
at jgi.BBDuk.main(BBDuk.java:76)
Comment
-
-
Order of adapters in adapte file matters for bbduk. Should it though?
Hi guys,
I have been playing with bbduk and the ref option to submit a list of adapters/contaminants.
I found that the order of the adapters in the ref matters and depending on which adapter is first in this file bbduk might take one over the other.
e.g. I changed the order and ended up having lots of "Bisulfite_R1" trimmed, but when the "Reverse_adapter" was first in the ref file it was used instead much more often on the same fq file.
>Bisulfite_R1
AGATCGGAAGAGCACACGTCTGAAC
>Reverse_adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Is this an intended behavior? It seems to me that this should not be the case.
Cheers,
Seb
Comment
-
-
@Seb: Brian does not seem to have time to respond to questions in this forum now a days but the different length of the adapters may have some bearing on this. Since the part you are looking for is identical (in bold) there is no need to add both copies. I assume you are trimming away sequence to the right(?) once that part in bold is located?
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
-
by SEQadmin2
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...-
Channel: Articles
07-08-2026, 05:17 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 07-24-2026, 12:17 PM
|
0 responses
31 views
0 reactions
|
Last Post
by SEQadmin2
07-24-2026, 12:17 PM
|
||
|
Started by SEQadmin2, 07-23-2026, 11:41 AM
|
0 responses
23 views
0 reactions
|
Last Post
by SEQadmin2
07-23-2026, 11:41 AM
|
||
|
Started by SEQadmin2, 07-20-2026, 11:10 AM
|
0 responses
215 views
0 reactions
|
Last Post
by SEQadmin2
07-20-2026, 11:10 AM
|
||
|
Started by SEQadmin2, 07-13-2026, 10:26 AM
|
0 responses
79 views
0 reactions
|
Last Post
by SEQadmin2
07-13-2026, 10:26 AM
|
Comment