Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #376
    Originally posted by laghs View Post
    I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.
    You may use the option:

    -5/--trim5 <int> trim <int> bases from 5' (left) end of reads

    such as "-5 1"
    Xi Wang

    Comment

    • James
      Member
      • Mar 2010
      • 23

      #377
      Index problem

      Hi,

      I've been using an index I created for a while now and just realized that the index is only for about half of the fastq file I wanted.

      So I carried out bowtie-inspect and I get this:

      bowtie-inspect -s indexes/cds
      Colorspace 0
      SA-Sample 1 in 32
      FTab-Chars 10
      assert_eq: expected (5320, 0x14c8) got (2526, 0x9de)
      bowtie_inspect.cpp:218
      Assertion failed: (0), function print_index_summary, file bowtie_inspect.cpp, line 218.
      Abort trap


      I have no idea how to go about fixing this. So any help would be much appreciated.

      Thanks, J

      Edit: I Fixed this by splitting up the FASTA file and building multiple indexes.
      Last edited by James; 07-14-2010, 08:33 AM. Reason: Resolution of problem

      Comment

      • genetic
        Junior Member
        • Jul 2010
        • 2

        #378
        Usual workstation OK?

        Hi all,
        I have tried running Bowtie on a PC with 300 GB disc, 2.66 GHz, 1.98 GB RAM. It says "out of memory allocating [ebwt] array for the Bowtie index".
        I want to map using the human hg18 genome. Are there some hints to run it on such PC or I really need more memory?
        Thanks.
        Last edited by genetic; 07-14-2010, 01:17 AM.

        Comment

        • axiom7
          Member
          • Aug 2009
          • 14

          #379
          Disparate results between -m1 and -a

          Hi,

          I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

          When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

          However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

          Two things don't make sense to me:

          1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

          2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

          Of course all runs specify -I700 -X1300.

          Thanks.
          Susan
          Last edited by axiom7; 07-15-2010, 12:45 PM.

          Comment

          • sdvie
            Member
            • Jul 2010
            • 68

            #380
            best alignment for paired-end reads

            Dear all,

            I am quite intrigued with Bowtie and the options it offers.
            When trying to figure out the best settings for my application, the following question arose:

            According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

            using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
            alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

            Many thanks for your comments!
            Sophia

            Comment

            • Xi Wang
              Senior Member
              • Oct 2009
              • 317

              #381
              Originally posted by sdvie View Post
              Dear all,

              I am quite intrigued with Bowtie and the options it offers.
              When trying to figure out the best settings for my application, the following question arose:

              According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

              using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
              alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

              Many thanks for your comments!
              Sophia
              I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.
              Xi Wang

              Comment

              • sdvie
                Member
                • Jul 2010
                • 68

                #382
                best alignment for paired-end reads

                Originally posted by Xi Wang View Post
                I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.
                Thanks for the comment. I realized that I actually made a mistake asking my question with the indicated parameters, since '-m 1' automatically reduces the output to reads with "unique" alignments, meaning that there is no sorting necessary.
                The question would rather be if I use the '-a' all alignment output option, whether then there would be a possibility to sort the achieved alignments.

                cheers,
                Sophia

                Comment

                • axiom7
                  Member
                  • Aug 2009
                  • 14

                  #383
                  More on disparate results between -a vs -m1

                  Hi again,

                  Have not gotten any reply to my posting, so I thought I'd make it a little easier for you. I am pasting the --12, 10-line input file and the two commands which quickly and easily reproduce my (perhaps perceived) problem. Again, the reference sequence is human chromosome 1.

                  Here are the two commands (assuming the --12 file is named x.12.fa and that the reference index is named hschr1):

                  bowtie -t -f --ff -I700 -X1300 -v0 -y -m1 hschr1 --12 x.12.fa
                  bowtie -t -f --ff -I700 -X1300 -v0 -y -a hschr1 --12 x.12.fa

                  And here is x.12.fa:

                  >0000000000 GAAGCTGAGGTGGGAGGATC IIIIIIIIIIIIIIIIIIII GCTAGGCGTGGTGGCTGGGA IIIIIIIIIIIIIIIIIIII
                  >0000000001 CCTGGTTCCTGGCACAGAGC IIIIIIIIIIIIIIIIIIII AGGCTGGTCTCAAACTCCTG IIIIIIIIIIIIIIIIIIII
                  >0000000002 GGAATTTTGTTCTTGCTCAT IIIIIIIIIIIIIIIIIIII GAGCAGTTAAAACAGTTGCT IIIIIIIIIIIIIIIIIIII
                  >0000000003 CCATAATATCTAGCCTGTAG IIIIIIIIIIIIIIIIIIII AACTACTGAAAAATTTTGAA IIIIIIIIIIIIIIIIIIII
                  >0000000004 GAACTCATCATTTTTTATGG IIIIIIIIIIIIIIIIIIII CATTGCTTTTGTCCCACCGA IIIIIIIIIIIIIIIIIIII
                  >0000000005 ATTCATATTGCTACTGAAAT IIIIIIIIIIIIIIIIIIII AGTCCATGAGTGCAGGGAAA IIIIIIIIIIIIIIIIIIII
                  >0000000006 AGAAAAGGCCAAACTCTGGA IIIIIIIIIIIIIIIIIIII AAAAAAAAGAAGAAGAAGAG IIIIIIIIIIIIIIIIIIII
                  >0000000007 GATGAAGACCACAGCATCAA IIIIIIIIIIIIIIIIIIII CATGTGTCTGCGCCTGCGCC IIIIIIIIIIIIIIIIIIII
                  >0000000008 ATGGTTCTTAGCTAGATTCA IIIIIIIIIIIIIIIIIIII GTTGTGTATATTTATCTCTT IIIIIIIIIIIIIIIIIIII
                  >0000000009 AGCTGAAAAATGGTTGAACC IIIIIIIIIIIIIIIIIIII TGGCTATGTGGGCTCTTTTT IIIIIIIIIIIIIIIIIIII

                  Thanks.
                  Susan


                  Originally posted by axiom7 View Post
                  Hi,

                  I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

                  When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

                  However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

                  Two things don't make sense to me:

                  1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

                  2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

                  Of course all runs specify -I700 -X1300.

                  Thanks.
                  Susan

                  Comment

                  • genetic
                    Junior Member
                    • Jul 2010
                    • 2

                    #384
                    Dummy question

                    Dear all,

                    I have tried running bowtie for the first time. I run it with the following parameters: ./bowtie -t -3 5 -p 8 hg19 reads/my_reads_file.txt hg19.map

                    However after the program has finished calculating, I do not see the output file. A second puzzling thing is that it writes to the screen that only ~1% of my reads mapped to the genome. Do you have any ideas what is wrong?

                    Thank you!

                    Comment

                    • axiom7
                      Member
                      • Aug 2009
                      • 14

                      #385
                      More on disparate results between -a vs -m1

                      Hi all,
                      I thought I asked a reasonable question...
                      Susan

                      Comment

                      • sdvie
                        Member
                        • Jul 2010
                        • 68

                        #386
                        Originally posted by axiom7 View Post
                        Hi all,
                        I thought I asked a reasonable question...
                        Susan
                        Hi Susan,

                        I am still a beginner in using Bowtie, but here go some suggestions and comments:

                        1. The x.12.fa is your input file, right? Have you tried to separate the two reads of the pairs into two separate files and then run the mapping? Why are you pasting the input sequences here, I thought you had doubts about the alignment results?

                        2. Have you tried each of these reads separately, lets say with the -a option?

                        Originally posted by axiom7 View Post
                        When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m.
                        3. As far as I understand, -m1 only reports reads with exactly one alignment, not at least one alignment.

                        Comment

                        • axiom7
                          Member
                          • Aug 2009
                          • 14

                          #387
                          Regarding the disparate -m1 vs -a

                          Thanks for a reply,

                          I posted the input reads so that someone could run bowtie using that input against human chromosome #1 and see the results for themselves, as it is so small and easily done.

                          I HAVE run the same input using two input fasta files and the results are identical. Easier to post the contents of the --12 file.

                          bowtie output tells you how many reads were "suppressed" due to the -m setting so the fact that pairs 1, 8 show up with -m1 and then show up multiple alignments with -a is not expected behavior as I understand it.

                          It's a good idea to run each pair by itself. I'll try that and see if it enlightens me further.

                          Thanks again.
                          Susan

                          Comment

                          • dcfargo
                            Member
                            • Aug 2008
                            • 22

                            #388
                            Please help with genome reseq parameter suggestion for PE 100mer data (D. melanogaster)

                            What are people going with as the 'default' alignment parameters/workflow?

                            I'm wondering if people are using -x and if so what value? Is it better to allow for structural variations with a large -x value or to even leave it out?

                            Is using -m1 and --max part of the workflow?

                            Also what combination of -l/-n/-e do people find works well with PE 100mers? Obviously it depends on data quality.

                            Comment

                            • kweber2
                              Member
                              • Aug 2010
                              • 10

                              #389
                              Can anyone tell me what this warning means? I can't find any documentation for it:

                              "Warning: Exhausted best-first chunk memory for read IPAR1:1:11:15296:1878:1#0/1 (patid 2434682); skipping read"

                              Thanks for any help!

                              -Kris

                              Comment

                              • edchen
                                Junior Member
                                • Aug 2010
                                • 1

                                #390
                                I'm running Bowtie for the first time and I keep getting:

                                Out of memory allocating the ebwt[] array for the Bowtie index. Please try
                                again on a computer with more memory.

                                I'm using the hg19 index and am running on a 32-bit system with 4 GB of memory. I've tried to reduce the memory usage with offrate, but it doesn't seem to help.

                                I've even gone so far as to boot into safe mode to use the command prompt with low memory use, and I don't see bowtie allocate anymore than 890 MB of memory.
                                Last edited by edchen; 08-20-2010, 08:14 AM.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 10:35 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-06-2026, 07:41 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                44 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                48 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...