Linker sequences for 384-sample NovaSeq setup?

[falconpunch]

Hi everyone! I'm talking with my core facility about doing a new custom-insert run on the NovaSeq (currently doing it on a HiSeq 2500 but want to switch for lower cost and more flexibility). The idea is just for me to amplify my insert myself using chimeric PCR primers that will add outer sequences for the standard "unique dual index" (UDI) barcoded primers to bind to. Then the core will do a final amplification with whichever UDI primers fit in with the other users on the machine, and sequence away.

My problem is that the core doesn't seem to know what the linker sequences are (seqs between the insert and the barcode+flowcell-binding-region). These linkers should be identical across all 384 primer sets they have.

Here's what I've found for the latest Nextera scheme according to the Illumina document that lists all current and legacy schemes/kits: (sequence I need to confirm is in bold)

PCR Primers

Index 1 Read
5′ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG

Index 2 Read
5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

So I think those in bold are the sequences I need to match my inner fragments to, but I'm really not sure as the core hasn't given me a firm answer on what kit they're using. Related questions that would be helpful to have answered are:

A) Are there many commercial kits out there offering 384-sample UDI barcoding? Or is Nextera the only one? There seem to be third-party vendors as well, but sequence info is hard to come by.
B) Don't the bold sequences above seem a bit short to be binding in a normal PCR? Tm is only around ~50C for each.

Thanks ahead of time!!

[pmiguel]

First, we should legally sanctify this thread:

Oligonucleotide sequences©2017Illumina,Inc. All rights reserved. Derivative works created by
Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited.

What you would want to add on to the outside of your primers would be:

Index1 side
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Index2 side
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

I don't like using Nextera adapters unless there is Tn5 involved in the library construction -- I don't see the point.
I wasn't aware the Illumina had a 384 UDI nextera primer kit.

--
Phillip