Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Simon Anders
    Senior Member
    • Feb 2010
    • 995

    #46
    Hi Keith

    Originally posted by krobison View Post
    I see HTSeq can read SAM files & assume it can also read BAM files. Can it retrieve BAM files from a remote (FTP or HTTP) location as samtools can? Is it using the samtools code or have you reimplemented this in Python?
    At the moment, HTSeq can natively only work with SAM files. Adding BAM support is on my to-do list, and of course, I would do it by simply wrapping the samtools.

    For now, however, you can simply call the 'samtools' binary from Python and pipe its output to HTSeq's SAM_Reader class. The following function does that for you:

    Code:
    import subprocess
    import HTSeq
    
    def BAM_Region_Reader( bamfile, region=None, samtools_exec="samtools" ):
    
       """Get Reader object for part of a BAM file
       
       bamfile -- a string, either a file name or an URL to a BAM file
       region -- a GenomicInterval
       samtools_exec -- file name (with path, if necessary) 
          of the 'samtools' executable
       
       Returns a SAM_Reader object.
       """
    
       cmd_line = ( samtools_exec , "view", bamfile )
       
       if region is not None:
          cmd_line += ( "%s:%d-%d" % 
             ( region.chrom, region.start, region.end ), )
    
       samtools_view = subprocess.Popen( cmd_line, 
          stdout = subprocess.PIPE )
    
       return HTSeq.SAM_Reader( samtools_view.stdout )
    With this, you can now do, e.g.:
    Code:
    bamfile = "ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data/HG00155/alignment/HG00155.chrom12.ILLUMINA.bwa.GBR.low_coverage.20100517.bam"
    region = HTSeq.GenomicInterval( "12", 90000, 91000, "." )
    
    for alignment in BAM_Region_Reader( bamfile, region ):
       print alignment
    Maybe not the optimum in performance but should do the job.

    Cheers
    Simon

    Comment

    • Simon Anders
      Senior Member
      • Feb 2010
      • 995

      #47
      Hi

      Originally posted by townway View Post
      Linux 2.6.18-194.8.1.el5 #1 SMP Wed Jun 23 10:52:51 EDT 2010 x86_64 x86_64 x86_64 GNU/Linux
      For Linux, please use the source version, this makes it easier for both of us. Please see here for instructions. (Do not use easy_install, rather, download the source package and install it as described.)

      Simon

      Comment

      • shurjo
        Senior Member
        • Jan 2009
        • 132

        #48
        Hi Simon,

        Many thanks for DESeq and HTSeq. I have been using BedTools to get the count data for DESeq analyses but would like to try HTSeq as well. However, after building it from source, I get the following error:
        Code:
        [sensh@saturn ~]$ python
        Python 2.6 (r26:66714, Oct  2 2008, 16:03:09) 
        [GCC 3.4.6 20060404 (Red Hat 3.4.6-9)] on linux2
        Type "help", "copyright", "credits" or "license" for more information.
        >>> import HTSeq
        >>> htseq-count --help
        Traceback (most recent call last):
          File "<stdin>", line 1, in <module>
        NameError: name 'htseq' is not defined
        It seems to me that I am missing something at a fundamental level. Any help from your part would be much appreciated.

        Thanks,

        Shurjo

        Comment

        • Simon Anders
          Senior Member
          • Feb 2010
          • 995

          #49
          Hi Shurjo

          htseq-count is a command-line tool. You start it from your shell, without first calling python.

          Simon

          Comment

          • shurjo
            Senior Member
            • Jan 2009
            • 132

            #50
            Thanks, Simon. I guess that is about as fundamental as an error can get on my part.

            Comment

            • shurjo
              Senior Member
              • Jan 2009
              • 132

              #51
              Hi Simon,

              I am getting the error below when running HTSeq-count with a SAM file produced by TopHatv1.0.14. The script works fine when tested with a smaller subset (head -1000000) from the same SAM file but fails on the bigger file, which has ~75 million reads. Maybe the last line in the error hints at a malformed SAM file?

              Any advice is much appreciated,

              Thanks,

              Shurjo

              Code:
              [sensh@saturn htseq_counts]$ python -m HTSeq.scripts.count -s no rep_C_08010264.SE.accepted_hits.sam ~/GTF_files/Homo_sapiens.withchr.NCBI36.50.gtf > rep_C_08010264.SE.htseq.counts
              Traceback (most recent call last):
                File "/home/pchines/lib/python2.6/runpy.py", line 121, in _run_module_as_main
                  "__main__", fname, loader, pkg_name)
                File "/home/pchines/lib/python2.6/runpy.py", line 34, in _run_code
                  exec code in run_globals
                File "/home/sensh/.local/lib/python2.6/site-packages/HTSeq-0.4.4p5-py2.6-linux-x86_64.egg/HTSeq/scripts/count.py", line 202, in <module>
                  main()
                File "/home/sensh/.local/lib/python2.6/site-packages/HTSeq-0.4.4p5-py2.6-linux-x86_64.egg/HTSeq/scripts/count.py", line 191, in main
                  sys.stderr.write( "Error: %s\n" % "; ".join( sys.exc_info()[1] ) )
              TypeError: sequence item 0: expected string, int found

              Comment

              • Simon Anders
                Senior Member
                • Feb 2010
                • 995

                #52
                Hi shurjo

                Could you please try again with the newest version, 0.4.4p6? The previous version, p5, had a bug in the error reporting which occludes the actual error message. The p6 version should give you a more informative error message, most likely pointing to a malformed line in your SAM file.

                Simon

                Comment

                • Anna Esteve
                  Junior Member
                  • Jan 2010
                  • 7

                  #53
                  Originally posted by Thomas Doktor View Post
                  I'm trying to use htseq-count version 0.4.2-p3 on a sam file produced by TopHat and a hg19 Ensembl GTF file. I'm analysing the reads in non-stranded mode and looking for exons in the gene_id features. The script runs for a while and outputs several warnings about reads incorrectly flagged as proper pairs, but then exits with the following error:
                  Is this an error in my sam file and if so how can I identify the read in question?
                  I am having the same problem as you, when i run HTseq-count I have warnings about improper mate pairs. Tophat sam output contains improper mate pairs (the mate is unmapped) as well as proper pairs. My question is if HTseq-count discards counts comming from improper pairs, if not how to deal with that?I have a great amount of improper pairs.
                  thanks.

                  Comment

                  • haomself
                    Junior Member
                    • Aug 2009
                    • 2

                    #54
                    Originally posted by Simon Anders View Post
                    Hi


                    I don't have much experience with SOLiD data, but I'd be interested to collaborate with a SOLiD-using bioinformatician to fill in the gaps in order to make HTSeq really useful for colour-space data. I think not much is missing for this.

                    Cheers
                    Simon
                    Simon,

                    I am testing htseq-count on SOLiD data. The sam file was generated using SHRiMP. It reported the following error message:

                    Error occured in line 1 of file rat1.saet.shrimp.sam.
                    Error: ("'seq' and 'qualstr' do not have the same length.", 'line 1 of file rat1.saet.shrimp.sam')
                    [Exception type: ValueError, raised in _HTSeq.pyx:621]

                    And here is the first few lines of the SAM file.
                    1241_771_1428_F3 0 chr1 12208 255 12H38M * 0 0 ATTGCCTCAGGTTCCCTCCTCAGTGTGTAGTGTGAGAT * AS:i:732 CS:Z:T11221133111133013022120102002202212111113211112113 XX:Z:ATTGCCTCAGGTTCCCTCCTCAGTGTGTAGTGTGAgaT
                    25_503_796_F3 0 chr1 12290 255 2H48M * 0 0 TGCTGCTTTGATTGTGTCCAGTGCCAAGAAAATGAGATTGCCAATGAT * AS:i:862 CS:Z:T22013213200123011122012113010220030120330130103033 XX:Z:TGCTGCTTTGATTGTGtCCAGTGCCAAGAAAatGAgaTTGCCAATgaT
                    25_503_796_F3 0 chr1 14756 255 2H48M * 0 0 TGCTGCTTTGATTGTGTCCAGTGCCAAGAAAATGAGATTGCCAATGAT * AS:i:862 CS:Z:T22013213200123011122012113010220030120330130103033 XX:Z:TGCTGCTTTGATTGTGtCCAGTGCCAAGAAAatGAgaTTGCCAATgaT

                    Do you have any suggestions on how to get around this?

                    Thanks.

                    Comment

                    • bbl
                      Member
                      • Jul 2010
                      • 16

                      #55
                      Hello Simon,

                      HTSeq seems to be the right tool I need for my work. I am trying to count how many times each base in an interesting region of exon has been covered by a read. Can 'counting' function in HTSeq do that? If so, how to do it?

                      Thanks

                      Comment

                      • yh253
                        Member
                        • Jul 2009
                        • 16

                        #56
                        Hi Simon,

                        I tried to use 'htseq-count' to count reads on UCSC hg19 known genes. My data is single end Illumina reads aligned to UCSC hg19 by bowtie with upto 10 multiple alignment allowed.

                        $head -n 30 test.sam
                        @HD VN:1.0 SO:unsorted
                        @SQ SN:chr1 LN:249250621
                        @SQ SN:chr2 LN:243199373
                        @SQ SN:chr3 LN:198022430
                        @SQ SN:chr4 LN:191154276
                        @SQ SN:chr5 LN:180915260
                        @SQ SN:chr6 LN:171115067
                        @SQ SN:chr7 LN:159138663
                        @SQ SN:chr8 LN:146364022
                        @SQ SN:chr9 LN:141213431
                        @SQ SN:chr10 LN:135534747
                        @SQ SN:chr11 LN:135006516
                        @SQ SN:chr12 LN:133851895
                        @SQ SN:chr13 LN:115169878
                        @SQ SN:chr14 LN:107349540
                        @SQ SN:chr15 LN:102531392
                        @SQ SN:chr16 LN:90354753
                        @SQ SN:chr17 LN:81195210
                        @SQ SN:chr18 LN:78077248
                        @SQ SN:chr19 LN:59128983
                        @SQ SN:chr20 LN:63025520
                        @SQ SN:chr21 LN:48129895
                        @SQ SN:chr22 LN:51304566
                        @SQ SN:chrX LN:155270560
                        @SQ SN:chrY LN:59373566
                        @SQ SN:chrM LN:16571
                        @PG ID:Bowtie VN:0.12.5 CL:"/bowtie -t -p 4 -v 2 -k 11 -m 10 --strata --best --sam hg19 test.fq test.sam"
                        HWI-EAS283_0007:1:1:1029:14030#NGCTAT/1 0 chrM 9647 255 30M * 0 0 CTCACCATAGTCTAATAGAAAACANNCGAA CCCCCCCCCACCCCCCCCCC########## XA:i:2 MD:Z:24A0C4 NM:i:2
                        HWI-EAS283_0007:1:1:1029:14030#NGCTAT/1 0 chr1 570195 255 30M * 0 0 CTCACCATAGTCTAATAGAAAACANNCGAA CCCCCCCCCACCCCCCCCCC########## XA:i:2 MD:Z:24A0C4 NM:i:2
                        HWI-EAS283_0007:1:1:1029:3318#NGCTAT/1 16 chr6 43491059 255 30M * 0 0 GAACNNACCAAGTTCTCTTCAGCACTTAGC ##########CCC;CCCBCCCCCCC@CCCC XA:i:2 MD:Z:4T0G24 NM:i:2
                        The GTF file was downloaded from UCSC known gene table:
                        $ head knownGene_hg19.gtf
                        chr1 hg19_knownGene exon 11874 12227 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
                        chr1 hg19_knownGene exon 12613 12721 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
                        chr1 hg19_knownGene exon 13221 14409 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
                        chr1 hg19_knownGene start_codon 12190 12192 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene CDS 12190 12227 0.000000 + 0 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene exon 11874 12227 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene CDS 12595 12721 0.000000 + 1 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene exon 12595 12721 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene CDS 13403 13636 0.000000 + 0 gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        chr1 hg19_knownGene stop_codon 13637 13639 0.000000 + . gene_id "uc010nxq.1"; transcript_id "uc010nxq.1";
                        I issued the following command to do the count:
                        htseq-count --stranded=no test.sam knownGene_hg19.gtf > test.count
                        However, only 30% of my reads successfully mapped to known genes, and over 50% of them were taken as 'ambiguous'. This happened to all my samples ( 2 samples with 4 biological replicates for each) by using any of the three modes: union/intersection-strict/intersection-nonempty. Do you think this is a problem with my gtf file or 'htseq-count' doesn't work well with my data? I appreciate any input!

                        $tail test.count
                        uc011nbv.1 0
                        uc011nbw.1 0
                        uc011nbx.1 0
                        uc011nby.1 0
                        uc011nbz.1 0
                        uc011nca.1 0
                        uc011ncb.1 0
                        uc011ncc.1 10
                        no_feature 1886981
                        ambiguous 3142708

                        Comment

                        • Simon Anders
                          Senior Member
                          • Feb 2010
                          • 995

                          #57
                          Hi yh253

                          Your GTF file does look strange. It is important that all exons from the same gene have the same gene_id. However, in your GTF file, the gene_id and the transcript_id seems to be the same. So, if a read maps to an exon shared by two transcripts of the same gene, htseq-count will see two different gene IDs and think that it is two different genes although it is only two different transcripts of the same gene.

                          It seems that UCSC and Ensembl disagree about what the point of the gene_id attribute in GTF files is. Maybe, try again with the GTF file from Ensembl. (But make sure the coordinates are the same.)

                          And make sure that strand option is set correctly.

                          Simon

                          Comment

                          • Simon Anders
                            Senior Member
                            • Feb 2010
                            • 995

                            #58
                            Hi

                            Originally posted by bbl View Post
                            HTSeq seems to be the right tool I need for my work. I am trying to count how many times each base in an interesting region of exon has been covered by a read. Can 'counting' function in HTSeq do that? If so, how to do it?
                            Sure, this should be possible with HTSeq. Do you have some basic knowledge of Python? If so, I can help you if you explain a bit more what exactly you want to do.

                            Simon

                            Comment

                            • yh253
                              Member
                              • Jul 2009
                              • 16

                              #59
                              Hi Simon,

                              Is it true that if a same read appears more than once in the alignment.sam, HTSeq-count will take it as ambiguous? I have an alignment files generated from bowtie which allows upto 10 multiple alignment for a single read (Multi-reads), i.e. a read may have more than one alignment records in the alignment.sam file. I got an impression that HTSeq-count didn't assign it to any gene.

                              Yuan

                              Comment

                              • Simon Anders
                                Senior Member
                                • Feb 2010
                                • 995

                                #60
                                Originally posted by yh253 View Post
                                Is it true that if a same read appears more than once in the alignment.sam, HTSeq-count will take it as ambiguous? I have an alignment files generated from bowtie which allows upto 10 multiple alignment for a single read (Multi-reads), i.e. a read may have more than one alignment records in the alignment.sam file. I got an impression that HTSeq-count didn't assign it to any gene.
                                HTSeq-count considers each line in the SAM file independently from all the others (except that paired reads are taken together). Hence, if a read appears 10 times in the file, it will be counted 10 times.

                                In your case, each of the 10 times, the read ended up to be counted as ambiguous, but the reason for this is probably not related to it being a multiply matching read.

                                S

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 10:35 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-06-2026, 07:41 AM
                                0 responses
                                26 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                45 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                48 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...