Tweet
Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?
-
-
Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.
Addendum : Those are just index/barcode sequences.Last edited by GenoMax; 10-23-2019, 04:48 AM. -
Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.Comment
-
The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.Comment
-
Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?
I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).Comment
-
You may not have any adapters present if your inserts were of a good size and there was no read-through.
BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.Comment
-
It should be TruSeq as FastQC would indicate. I am not sure but you can try following:
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTComment
-
Thanks a lot!
Comment
-
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...Today, 05:17 AM -
Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.07-01-2026, 11:43 AM
-
I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.
Here are nine questions we think about, in roughly the order they matter, before...
Comment