Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?
-
-
Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.
Addendum : Those are just index/barcode sequences.Last edited by GenoMax; 10-23-2019, 04:48 AM. -
Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.Comment
-
The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.Comment
-
Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?
I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).Comment
-
You may not have any adapters present if your inserts were of a good size and there was no read-through.
BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.Comment
-
It should be TruSeq as FastQC would indicate. I am not sure but you can try following:
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTComment
-
Thanks a lot!
Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment