QIAseq FX DNA Library Kit adapters for trimming

[ciemanek]

Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?

[GenoMax]

Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGEN® QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.

Addendum : Those are just index/barcode sequences.

[ciemanek]

Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.

[nucacidhunter]

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.

[ciemanek]

Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?

I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).

[GenoMax]

You may not have any adapters present if your inserts were of a good size and there was no read-through.

BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.

[nucacidhunter]

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

[ciemanek]

Thanks a lot!