Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?
Unconfigured Ad
Collapse
X
-
-
-
Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.
Comment
-
The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.
Comment
-
Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?
I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).
Comment
-
You may not have any adapters present if your inserts were of a good size and there was no read-through.
BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.
Comment
-
It should be TruSeq as FastQC would indicate. I am not sure but you can try following:
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 08-13-2026, 12:22 PM
|
0 responses
25 views
0 reactions
|
Last Post
by SEQadmin2
08-13-2026, 12:22 PM
|
||
|
Started by SEQadmin2, 08-11-2026, 10:35 AM
|
0 responses
21 views
0 reactions
|
Last Post
by SEQadmin2
08-11-2026, 10:35 AM
|
||
|
Started by SEQadmin2, 08-06-2026, 07:41 AM
|
0 responses
36 views
0 reactions
|
Last Post
by SEQadmin2
08-06-2026, 07:41 AM
|
||
|
Started by SEQadmin2, 08-03-2026, 10:13 AM
|
0 responses
51 views
0 reactions
|
Last Post
by SEQadmin2
08-03-2026, 10:13 AM
|
Comment