Can I use default sequencing primers for Miseq?

[Tom2013]

I use below PCR primers to prepare libraries for Miseq amplicon sequencing:

i7-INDEX2-Spacer- gene_specific_Primer

CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG +gene_specific_Primer

i5-INDEX2-Spacer+gene_specific_Primer
AATGATACGGCGACCACCGAGATCTACAC-CTCTCTAT-TCGTCGGCAGCGTC+gene_specific_Primer

Compared to Nextera adapters, my primers do not include the tagmentation sequence. I tried to look up Miseq sequencing primers, but still not sure whether my adapters are compatible with Miseq sequencing primers.

Can I use default sequencing primers in Miseq cartridge for sequencing? Does anybody know any website or document to verify that?

[ATϟGC]

My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-11.pdf

[Tom2013]

My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf

Thanks a lot for your reply.
Are there any document/post(s) mention that "the sequencing primer binding site is actually contained within the Nextera transposase sequence"?

[Tom2013]

My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf

You are right!