Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • christophpale
    Member
    • May 2010
    • 16

    BWA unique mapping, mutireads

    Hi,
    Question: What is the best way to remove reads that map to multiple locations?

    What I have done so far:
    I have a 76x2 paired end data which I mapped to hg18 using BWA.
    I want to get rid of reads that map to multiple locations, so I was
    told to use the cutoff of -q 1 in samtools view;
    however, to my surprise, I have reads with non-zero quality but appear to map to alternative locations with the same score.
    For example, this read maps to chr1 and also to chrM

    Code:
    PF_Y_612GW_I581:100617:1:21:8990:3211#0 89      chr1    557906  23      76M     *       0       0       CCCATGGCCTCCATGACTTTTTCAAAAAGATATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGC    HHHHDHH>HBHHHHHHGHHHH>HGHHHHHHHHGFHHHHHFHGGDGGDHHHHFHFHHHHHHHHFHHHEHHHGGDGGG    XT:A:U  NM:i:0  SM:i:23 AM:i:0  X0:i:1  X1:i:1  XM:i:0  XO:i:0  XG:i:0  MD:Z:76 XA:Z:chrM,-7493,76M,1;
    XA tag is the BWA optional field and if I understand correctly it means that this sequence also mapped to chrM with 100% matches;
    so it appears that it is not sufficient to use the -q 1 as the flag to remove multiple hits.

    Can someone tell me if I am correct; and also what is the best way to get rid of reads that align non-uniquely on the genome.


    thanks
    Christoph
  • lh3
    Senior Member
    • Feb 2008
    • 686

    #2
    Mapping quality. See samtools FAQ.

    Comment

    • hash
      Junior Member
      • May 2010
      • 3

      #3
      Mismatch threshold for both reads in a paired-end run

      Hi,

      One of my colleagues has found that when he aligns 80bp paired-end reads using bwa that the mismatch threshold only applies to any one of the two sequences and the other can have as many mismatches as permitted. For example, one paired read can have the default two mismatches and the other paired read had 45 mismatches. Is there an option in bwa to set the mismatch level on both paired reads because it is going to be quite unproductive to have to parse the resulting SAM file. Please give me some good news with regard to phantom parameters. Look forward to hearing from you.

      Harshil

      Comment

      • lh3
        Senior Member
        • Feb 2008
        • 686

        #4
        It cannot be 45 mismatches. It must be soft clipping.

        For PE reads, bwa runs SW alignment for unpaired mate. SW is much more permissive. This procedure is rewritten in the paper, not phantom. You may filter the alignment if you do not like them.

        Comment

        • donniemarco
          Member
          • Aug 2009
          • 17

          #5
          bwa minimum map quality

          Is there as anything as minimum or optimal mapq in the bwa.

          I plan to take unique query sequences with highest mapq but still not able to figure the cutoff to use it for the analysis.

          Any help is appreciated!!

          Comment

          • aleferna
            Senior Member
            • Sep 2009
            • 121

            #6
            Minimum MapQ value in BWA.

            I ran some simulations with bwa in Single End Mapping and it really depends on the read length and the number of mismatches. Also the mapq value of BWA ALN (the short aligner) you should use MapQ > 30 anything less than that you pretty much cannot trust. If you use bwasw you can use a MapQ of 10. These 2 settings should give you >99% accuracy in the mapping, specially if you increase the sensitivity in BWASW (Z > 100). This however is for Single End mapping not Paired End mapping.

            Hint: 45 mismatches is probably a paired end adapter, did you mask your sequences ? Its a good idea to check your fastq file for the Solexa PE adapters. In my case I had A LOT of contamination from these adapters, that makes it harder to map. I have a small python script to filter a fastq file if you want it.
            Last edited by aleferna; 08-06-2010, 05:06 AM.

            Comment

            • donniemarco
              Member
              • Aug 2009
              • 17

              #7
              thanks for your reply Aleferna. Its a great help. I have cleaned my sequences already.

              Comment

              • frymor
                Senior Member
                • May 2010
                • 151

                #8
                Originally posted by aleferna View Post
                Minimum MapQ value in BWA.
                I have a small python script to filter a fastq file if you want it.
                Hi,

                I would like to have a look at the python script.

                I run the fastqc software on my data before start using the bwa algorithm. I found out that at both ends there are still some adapter sequences which I would like to trimm.

                It would be great if I can have a look at your script.

                Comment

                • mghita
                  Member
                  • Aug 2011
                  • 10

                  #9
                  Hi,

                  What options should I use in bwa in order to obtain perfect maps only? I have two references and I would like to get the unique perfect maps to both of them (in two different files if possible).

                  Thanks!

                  Comment

                  • donniemarco
                    Member
                    • Aug 2009
                    • 17

                    #10
                    Originally posted by mghita View Post
                    Hi,

                    What options should I use in bwa in order to obtain perfect maps only? I have two references and I would like to get the unique perfect maps to both of them (in two different files if possible).

                    Thanks!
                    I think its -F 4 option in BWA!!!

                    Comment

                    • swbarnes2
                      Senior Member
                      • May 2008
                      • 910

                      #11
                      Originally posted by donniemarco View Post
                      I think its -F 4 option in BWA!!!
                      I don't see -F as an option in either bwa aln or sampe

                      but bwa aln -n 0 might do the trick. Or, if you already have sam files, you could filter them with grep to only contain lines with "NM:i:0" That means a perfect match.

                      Comment

                      Latest Articles

                      Collapse

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 06-09-2026, 11:58 AM
                      0 responses
                      13 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-05-2026, 10:09 AM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-04-2026, 08:59 AM
                      0 responses
                      36 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-02-2026, 12:03 PM
                      0 responses
                      60 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...