Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mmhefny
    Member
    • Apr 2020
    • 10

    #1

    empty fastq files after Miseq is done

    Dear all,
    I am new in this field and I done my first sequencing using MiSeq. I checked the files and found that all generated fastq.gz files are empty except two files with names Undetermined_****.fastq.gz are in the Data/Intensities/BaseCalls/ folder which has data (each is about 200 kb).

    Could you please help me to explain where is the problem?

    Thank you
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Sounds like you had a demultiplexing failure. Check your sample sheet one more time (easy mistake is to provide the indexes in rev-comp) and re-queue demultiplexing. You should use Illumina Experiment Manager software (windows only) available from Illumina to make the sample sheet, if you are new to sequencing.

    At worst, your run may have failed. Best solution to check on either possibilities is to contact Illumina tech support. They should be able to take a look at your MiSeq remotely (if your MiSeq is not on network then they will ask for a few files) and diagnose.

    Comment

    • mmhefny
      Member
      • Apr 2020
      • 10

      #3
      Thank you.

      I will check both possibilities. I looked at the CompletedJobInfo file and it seems to be fine. I attached also my samplesheet file. I hope you have time to check them.

      I really appreciate your efforts.
      Attached Files

      Comment

      • mmhefny
        Member
        • Apr 2020
        • 10

        #4
        Originally posted by GenoMax View Post
        Sounds like you had a demultiplexing failure. Check your sample sheet one more time (easy mistake is to provide the indexes in rev-comp) and re-queue demultiplexing. You should use Illumina Experiment Manager software (windows only) available from Illumina to make the sample sheet, if you are new to sequencing.

        At worst, your run may have failed. Best solution to check on either possibilities is to contact Illumina tech support. They should be able to take a look at your MiSeq remotely (if your MiSeq is not on network then they will ask for a few files) and diagnose.
        Thank you.

        I will check both possibilities. I looked at the CompletedJobInfo file and it seems to be fine. I attached also my samplesheet file. I hope you have time to check them.

        I really appreciate your efforts.

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          It won't be very useful to look at the Samplesheet. If MiSeq accepted it at run time then it must have been in the correct format. If your samples did not demultiplex then it is very likely that you have wrong index sequence information in your samplesheet.

          Can you post a screenshot of the Sequence Analysis Viewer info for this run? Especially the alignment to phiX. That would be useful for diagnosis.

          Comment

          • mmhefny
            Member
            • Apr 2020
            • 10

            #6
            Originally posted by GenoMax View Post
            It won't be very useful to look at the Samplesheet. If MiSeq accepted it at run time then it must have been in the correct format. If your samples did not demultiplex then it is very likely that you have wrong index sequence information in your samplesheet.

            Can you post a screenshot of the Sequence Analysis Viewer info for this run? Especially the alignment to phiX. That would be useful for diagnosis.
            Unfortunately due to COVID 19 measures I have no access to the MiSeq machine now. I only have the run files. Also we did not include phiX sample control. Is there any file in the run folder can be representative so that I share it with you?

            I really appreciate your help.

            Comment

            • GenoMax
              Senior Member
              • Feb 2008
              • 7142

              #7
              Are you able to use command line? If you are I can suggest some options to look at those "Undetermined" files to see what may be going on.

              If you are able to open them (on PC/Mac) post a small number of example reads here.

              Comment

              • jdk787
                josh kinman
                • Apr 2014
                • 72

                #8
                If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

                It's located at
                <run folder>\Data\Intensities\BaseCalls\Alignment
                Josh Kinman

                Comment

                • mmhefny
                  Member
                  • Apr 2020
                  • 10

                  #9
                  Originally posted by GenoMax View Post
                  Are you able to use command line? If you are I can suggest some options to look at those "Undetermined" files to see what may be going on.

                  If you are able to open them (on PC/Mac) post a small number of example reads here.
                  Yes I can. Here are some reads
                  @M02006:24:000000000-J397M:1:1101:17423:1618 2:N:0:0
                  CATTGTTCCTTTTGCTTCTTTCCTTTCCCTCTTCTCTTTCTTTTCTCTTCTCTCCTTCTTTTTTCTTTTTTGCCTCTCTTGTTTTCTTACTCTCTTTCCCCCTCTTTTTTCTCTTTCTTTCTTCTCCCTCTCTCTCCCTCACCTTTTCTAT
                  +
                  1111>3333B@3111A13D1331333111A0011A133333111212D212A210111111D1/011111/A1111B01A111002D12111211212110///01B11/012@21221B2212B1100000111100000/0111121B2
                  @M02006:24:000000000-J397M:1:1101:17369:2159 2:N:0:0
                  TCGCCGGCCTAGTAGGCCCTTCCCTTAGTCTCCTTCTTCTCGCTGCATTCTGACACCCCGGCTCTCTACTTGGCGCTGCTCAACTTTCTAATGTGGCCGCGCGTCGTGTAGGGCACTAGTGTCGTCCTGCGTGTCGATCTCGGAGGTCGCG
                  +
                  11111>>1100B1AG11B00A000111B22211B111D22B///B/A1222221B1///A////0112D211F0@//E/1111021FD2222B2BF/B>///>//</?/011?0//01?1?1</<//.<1>.<>0CA<..0<..--./:--
                  @M02006:24:000000000-J397M:1:1101:18125:2191 2:N:0:0
                  CCCCTTTCCCTCTGTCTTCTCCCTCGGCGCCTTCTTTGCTCTTCTCGCCGGCTTCGTTGTCCGCGCGTCGTGTCGTGCCCGCGTGTCCCGCTGGTTGTCGCTCTCTGTTGTCGCCGTCTCCTTCCCCCCCCGCCTGCCCTCCCCTTCTGTT
                  +
                  11>11111111>11B333331AA1BA0000A00111A111A1112BA/A//A//0>000B11//>////>///0///</0//////011/////01/?1/////1111<101<..-<-./00<0///<------...../....9.-////
                  @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                  GTTTTTCCTCGTCTGCCCGGCCTCCGTTCTTTCTTTCTCTTCTCCCCGTGCTGCTTCCCGCTTCTTCTCCTTTGCACCCCTCTTTCTTCCTGGTCCTCTTGGCGTGCGCCTTCTTGCCTCTTCCTCCCTGTCTCCCGTTTGTCCGCACGTG
                  +
                  1>111111311>11A1111000000BA100AA22D12BA2212110///B//1A11110/////11221111211210///?01122121@101111111110///?><///111111111111110/01<12>10//00/021/////0.
                  @M02006:24:000000000-J397M:1:1101:17741:4534 2:N:0:0
                  CTTCTCTTTTCTTTTCGGCGCTTGCTCCGGTCTCCTTGGCCCCTCCTTCCGTCTCCTGCTTCGCGCTGCCTTCGGTCGCCCCGGGCCCTTCCTTGGCGCTGGGCCGCGCGTCGTGTCGGGCCCGCGTGTCCCCGCGTGTGTCGATCTCGGT

                  Comment

                  • mmhefny
                    Member
                    • Apr 2020
                    • 10

                    #10
                    Originally posted by jdk787 View Post
                    If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

                    It's located at
                    <run folder>\Data\Intensities\BaseCalls\Alignment
                    Yes I can see this file. None of the barcodes which I used has hit and only some hits are for different barcodes

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      #11
                      @mmhefny,

                      Are you sure this run was set up to run a index cycle? This run header does not seem to make it look so.

                      Code:
                      @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                      Normally one should see something like this at the end of fastq header for index sequence

                      Code:
                      @M02006:24:000000000-J397M:1:1101:21922:3716 1:N:0:GAACGCAA+CTGGCACT
                      Can you find the RunInfo.xml file and post the section that shows this part?
                      Code:
                      <Reads>
                            <Read NumCycles="150" Number="1" IsIndexedRead="N" />
                            <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                            <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                            <Read NumCycles="150" Number="4" IsIndexedRead="N" />
                          </Reads>

                      Comment

                      • mmhefny
                        Member
                        • Apr 2020
                        • 10

                        #12
                        Originally posted by GenoMax View Post
                        @mmhefny,

                        Are you sure this run was set up to run a index cycle? This run header does not seem to make it look so.

                        Code:
                        @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                        Normally one should see something like this at the end of fastq header for index sequence

                        Code:
                        @M02006:24:000000000-J397M:1:1101:21922:3716 1:N:0:GAACGCAA+CTGGCACT
                        Can you find the RunInfo.xml file and post the section that shows this part?
                        Code:
                        <Reads>
                              <Read NumCycles="150" Number="1" IsIndexedRead="N" />
                              <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                              <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                              <Read NumCycles="150" Number="4" IsIndexedRead="N" />
                            </Reads>
                        This part of RunInfo.xml is as follow
                        Code:
                            <Reads>
                              <Read NumCycles="151" Number="1" IsIndexedRead="N" />
                              <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                              <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                              <Read NumCycles="151" Number="4" IsIndexedRead="N" />
                            </Reads>
                        Last edited by GenoMax; 04-02-2020, 10:54 AM. Reason: Added [code]tags

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          #13
                          Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                          What do you see in DemuxSummaryF1L1.txt?

                          Scroll down the file until your see this section:
                          Code:
                          ### Most Popular Unknown Index Sequences
                          ### Columns: Index_Sequence Hit_Count
                          CTCATCAC+GGTGGCAC       2940
                          AGGTCAAG+CGCGTAAT       860
                          TCCAGGTA+GCTTCAGT       700

                          Comment

                          • mmhefny
                            Member
                            • Apr 2020
                            • 10

                            #14
                            Originally posted by GenoMax View Post
                            Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                            What do you see in DemuxSummaryF1L1.txt?

                            Scroll down the file until your see this section:
                            Code:
                            ### Most Popular Unknown Index Sequences
                            ### Columns: Index_Sequence Hit_Count
                            CTCATCAC+GGTGGCAC       2940
                            AGGTCAAG+CGCGTAAT       860
                            TCCAGGTA+GCTTCAGT       700
                            they are:

                            ### Most Popular Index Sequences
                            ### Columns: Sequence ReverseComplement HitCount
                            Index
                            C.CCC.CC GG.GGG.G 96
                            C.CCT.GC GC.AGG.G 94
                            C.CGC.CG CG.GCG.G 78
                            C.GCC.TT AA.GGC.G 65
                            C.ACC.CT AG.GGT.G 44
                            C.CCC.CT AG.GGG.G 40
                            C.ACG.GG CC.CGT.G 38
                            C.CGC.GG CC.GCG.G 37
                            C.AGC.GG CC.GCT.G 36
                            C.CGC.TC GA.GCG.G 33
                            C.CCC.CG CG.GGG.G 29

                            Comment

                            • mmhefny
                              Member
                              • Apr 2020
                              • 10

                              #15
                              Originally posted by GenoMax View Post
                              Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                              What do you see in DemuxSummaryF1L1.txt?

                              Scroll down the file until your see this section:
                              Code:
                              ### Most Popular Unknown Index Sequences
                              ### Columns: Index_Sequence Hit_Count
                              CTCATCAC+GGTGGCAC       2940
                              AGGTCAAG+CGCGTAAT       860
                              TCCAGGTA+GCTTCAGT       700
                              This is the file and it does not have this Unknown Index Sequences
                              Attached Files

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 12:22 PM
                              0 responses
                              12 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-11-2026, 10:35 AM
                              0 responses
                              14 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-06-2026, 07:41 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              50 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...