Searching for Bisulfite sequencing primers

[aleferna]

This is a really silly question, but I'm trying to find out the location of a primer in the original genome but I can't find them.

If I have the following sequence how can I find where it came from?
GGTTAGGTGAAGGTTTTGTGGGTAGTTATA

[fkrueger]

You could just run your primer sequence of interest through a bisulfite mapping pipeline. We use a program called Bismark which is pretty straight forward to use (http://seqanswers.com/forums/showthr...hlight=bismark). All associated files can be downloaded from http://www.bioinformatics.bbsrc.ac.uk/projects/.

You would have to index your genome of interest first which might take a while though. If you don't want to go through all the hassle you can just send me an email with the genome build you are interested in (human, mouse....) and I will try to find the location for you on Monday morning. My email address is [email protected].

Best wishes,
Felix

[fkrueger]

Dear Aleferna,

I just used Bismark to determine the binding position of your unknown bisulfite oligo. There are no unique alignments to the human genome builds NCBI36 or GRCh37, but several ambiguous alignments with 2 or more mismatches.

However alignment to the mouse genome (build NCBIM37) gives a perfect match:

unknown_oligo
- (alignment orientation)
7 (chromosome)
149851590 (alignment start)
149851619 (alignment end)
GGTTAGGTGAAGGTTTTGTGGGTAGTTATA (your sequence of interest)
GGTCAGGTGAAGGCTCTGTGGGCAGCCACA (genomic equivalent sequence)
...c.........c.c......c..cc.c. (methylation call (lower case c indicates converted cytosines))


I hope that the organism you are working with is indeed mouse. If you need anything else don't hesitate to contact me.

[aleferna]

Hey thanks yes its the mouse actually, thats exactly what I was looking for!