Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mforthman
    Junior Member
    • Sep 2021
    • 1

    #1

    bbmap inflating read count and not finding one sequence after header

    I'm using bbmap to map transcriptome reads to a set of target loci. I'm working with 12 samples with pair-end reads and 1 sample with single-end reads, all from NCBI's SRA. I'm having no problems with bbmap reading paired-end data and completing analyses correctly. It's the one sample with single-end reads that's causing two issues:

    1. The first issue is that the input fasta file only has 288915 reads. I have confirmed this with grep ">" file.fasta | wc -l. However, bbmap reports "Reads used: 308655". I have no idea why the read count is inflated; again, this is not an issue with the paired-end data.

    2. bbmap fails to recognize a sequence immediately after the fasta header: "Warning: A fasta header with no sequence was encountered: SRR768524.9631" The sequence in question is formatted exactly like all others in the file and I have checked the EOL, which is fine. Below is what a snippet of the fasta file looks like, with the 3rd sequence being the problematic one for bbmap.

    >SRR768524.9629
    CTATCAAAGGGAAATCCCGCTGGCCTGCTATCATACAGTCTTGAACCTCCACATGCAATATCAGCTGAATCTCCAACGTGGCCGCTGACAAATGGAGTAACTACGACTGCCAAAACGAAAGCGCGACCTCCTTTCCATCCCATGGGTAATTGGAGTCTTTGAGGAAATCCACATCGGCCAGCCTCTGAATAATGGAATGGTTCCTTCTGGTTGAGTGCACTGTTTATTGAAGTGTAAAGAGACCTGAATCCTTCTTGGTCATGGATAAAGAGGGGAGAATCTGTTGAACTTCTTTCCCACACATTAACACCCTCAGTCAATTTTACTGGGAAACGGTCAATTTCAAATAAGCTAGTTTTGCTTGGTCATAAGTGAGGAAATGTTCATCAGAATCATATTTCGGTCCAATGAATACTCTCACAATGGCATCATCAGCTTTT
    >SRR768524.9630
    ATAATGCAATTATAGATTGTTGGAGTGCAGGTAAAGCTACCACTGTTATGATTAAAGATAATCCAAAGGTTGAAATTCTTGATGTAGAAGATGTTAAGGTTGGAAAGATAAGACAATTTTGTGAGTTGGACTTGGCATTGAACATGGCCTTACGAAAGTATTTTGGTAGTGTGTTTGATAAAATGGCAGTTACATCTAATGAAACGCCGTGGAAAGTTGCTTGGAATCCATATTTTATGCCTCATCACATCGTGGCGATAGAGAACGACAAGTACGATGTCTTTTGTATAGATGTGAAAAGAATGGATAAGAATTTACCAGTCCAATTCACTGAGATATTGTGT
    >SRR768524.9631
    TGTTACTGGGTAGGGCTGTGGCACTGGGACCTTGACTGGATAGGGTACATGCTTCTCGACTGGTACTGGGTATGGCTTGGGAATGTGGACAGGGTATGGCCTATCGACTGGGACCTTCACGGGATAGGGAACTTTCTTCTCGATATGGACTGGATAAGGTACTGGTACCTCCTTGTGGATGGTGATAGCTTTAATGTGGCCGTGTTCCTCATGTCCTCCGAGTTCATAGCCACCTCCATATCCGTATCCTCCTAAGTCATGTCCACCTCCATATCCTCCATGTCCACCGCCGTATCCTCCAAGCTCATAACCACCTCCATATCCTAAGCCAAGAAGTCCTCGTTTCTCCTGCTTCTTGTCATCTGTTGGTGCCGCTGCTTTGTCGGTCTTGGATTCGGCCTTCTTCTCTTCAGCTGATGCTGTGGCAAGCAGTGCCAACAGCCCTACCCACAGTACCTTGGATTGCATTGTTGAGTCGTGGTGTGGTCGGCGTCTCCCAA
    >SRR768524.9632
    AATTCCCAACGACCAAGTATCTGAACATGAGTGGATCAATGCTGAGATCCTGCCTGCTACTGCTATTCCTAGCTTACTGTGTGTCCTGCTATAGAAGTCATGTTCCTAGAGGCGGGAGTTACTCTCTACCGCCTGGAGTTAATCCAACATTCCCAGGAAGGAACCAAGGACTGCCTCCGGCTTATCATGGAAAATTCAAGAGATCACTGGAAGGAGGTTTAGAACCTGAAGATGGTGGTGTCCTTGCAGTTGATGAACCTGCTGATTATCTGAAAGTCAAAAGGTCAGTGGAAGATGTTGAAGGTGAATTCCTTGTGAACGAAGAACCTCAAGAATTTGAGACACTGAGAGCGCGCCGTGACGTCAGAATAATTCATCCAACT
    >SRR768524.9633
    TTCCAAACTGTCGATTCATGATGTACACAATACCAAAAAAGGCAAATAAGAAATAAAAGT
    I'm at a loss for figuring out how to resolve these issues. I appreciate any help in getting this to run properly on this last fasta file.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Is there a specific reason you converted these reads to fasta format? If this is data from SRA then you should be able to map the fastq reads directly.

    You may be getting secondary alignments and that may be the reason why your read count seems inflated.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 08-13-2026, 12:22 PM
    0 responses
    29 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-11-2026, 10:35 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    38 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    51 views
    0 reactions
    Last Post SEQadmin2  
    Working...