Unconfigured Ad

Collapse
X
Collapse
 
  • Page of 1
  • Filter
  • Time
  • Show
Clear All
new posts
Previous template Next
  • abubd
    Junior Member
    • Oct 2021
    • 2
    #1

    mapping with bbmap anderror

    I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.

    I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.

    Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)

    Code:
    job starting at 09:42:42
java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto]
Version 38.61

Scaffold statistics will be written to 2008_27.scafstats
Set threads to 20
Ambiguously mapped reads will be considered unmapped.
Set genome to 1

Loaded Reference:       2.025 seconds.
Loading index for chunk 1-1, build 1
Generated Index:        3.261 seconds.
Analyzed Index:         2.517 seconds.
Started output stream:  0.371 seconds.
Started output stream:  0.023 seconds.
Creating scaffold statistics table:     0.065 seconds.
Cleared Memory:         0.516 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 20 mapping threads.
Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG  0       -1      +       -1      -1      00000000000000000000000 1       0       0       ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG    601     -1      +       -1      -1      00000000001000000000000 1       0       0       CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF .       .       .       .       1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG  1002    -1      +       -1      -1      00000000000000000000000 1       0       0       GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF .       .       .       .       1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823      1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG  1404    -1      +       -1      -1      00000000001000000000000 1       0       0       NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .       1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG   3802    -1      +       -1      -1      00000000001000000000000 1       0       0       GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF  .       .       .       .       1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0  1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)


-------------------
---------------------
-----------------------------


, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19

**************************************************************************
Warning!  20 mapping threads did not terminate normally.
Check the error log; the output may be corrupt or incomplete.
Please submit the full stderr output as a bug report, not just this message.
**************************************************************************


   ------------------   Results   ------------------

Genome:                 1
Key Length:             13
Max Indel:              16000
Minimum Score Ratio:    0.56
Mapping Mode:           normal
Reads Used:             212     (28878 bases)

Mapping:                0.669 seconds.
Reads/sec:              316.77
kBases/sec:             43.15


Pairing data:           pct pairs       num pairs       pct bases          num bases

mated pairs:              2.8302%               3         1.9600%                566
bad pairs:                0.0000%               0         0.0000%                  0
insert size avg:           97.67


Read 1 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9552%                283
unambiguous:              2.8302%               3         1.9552%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           0.9434%               1         1.0432%                151

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        86.9258%                246
Error Rate:             100.0000%               3         9.1873%                 26
Sub Rate:               100.0000%               3         9.1873%                 26
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         3.8869%                 11


Read 2 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9647%                283
unambiguous:              2.8302%               3         1.9647%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           1.8868%               2         1.8189%                262

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        89.0459%                252
Error Rate:             100.0000%               3         9.5406%                 27
Sub Rate:               100.0000%               3         9.5406%                 27
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         1.4134%                  4
Exception in thread "main" java.lang.AssertionError:
The number of reads out does not add up to the number of reads in.
This may indicate that a mapping thread crashed.
If you submit a bug report, include the entire console output, not just this error message.
3+0+0+82+1+0 = 86 != 106
        at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961)
        at align2.AbstractMapper.printOutput(AbstractMapper.java:1059)
        at align2.BBMap.testSpeed(BBMap.java:522)
        at align2.BBMap.main(BBMap.java:35)
job finishing at 09:42:59
    Last edited by abubd; 10-25-2021, 12:54 AM.
    Tags: None
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142
    #2
    Do you have 20 cores available on the machine for BBMap to use. What happens if you assign fewer cores? Starting with 8 would be a good number.

    Comment

    • abubd
      Junior Member
      • Oct 2021
      • 2
      #3
      Yes, cores are available as I did run it in a computer cluster. That is not a problem I think.

      Latest update: When I changed
      rescuemismatches 1 to 2
      . It started working but for a long time, 2 hours and the job is canceled due to the time limit that means I need more time to assign for this run with 20 cores (1 node). so far resulting files are:
      22G Oct 25 13:42 2008-27-201.aligned.sam
      120G Oct 25 13:42 2008-27-201.unaligned.sam
      But I want a unique reads that should not be so much!

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142
        #4
        I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.
        If you need full length perfect alignments in your final file then I suggest that you try "perfectmode=t minid=1 mappedonly=t" options. If your reads are longer than 150 bp then you may need to modulate minid parameter. Add secondary=t if you want secondary alignments.

        Comment

        • yangkuki
          Junior Member
          • May 2022
          • 1
          #5
          I'm doing some research on this as well, but found little information

          Comment

          Previous template Next

          Latest Articles

          Collapse
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has            ...
            Yesterday, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM
          View All

          ad_right_rmr

          Collapse

          News

          Collapse
          Topics Statistics Last Post
          Single-Cell Atlases Skew Toward European Ancestry, Analysis Finds by SEQadmin2
          Started by SEQadmin2, Yesterday, 11:10 AM
          0 responses
          9 views
          0 reactions
          		 Last Post SEQadmin2
          by SEQadmin2
          Yesterday, 11:10 AM  
          UC San Diego Bioengineers Map Gene Function in Human Stem Cells by SEQadmin2
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          30 views
          0 reactions
          		 Last Post SEQadmin2
          by SEQadmin2
          07-13-2026, 10:26 AM  
          New Analysis Splits Leukemia Into 16 Epigenomic Subgroups by SEQadmin2
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          40 views
          0 reactions
          		 Last Post SEQadmin2
          by SEQadmin2
          07-09-2026, 10:04 AM  
          Genome-Wide CRISPR Screen Uncovers Unlikely Psoriasis Target by SEQadmin2
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          25 views
          0 reactions
          		 Last Post SEQadmin2
          by SEQadmin2
          07-08-2026, 10:08 AM  
          View All
          Working...