Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • tanghz
    Junior Member
    • Sep 2010
    • 3

    #1

    BFAST mapping paired end reads.

    Hi have a set of data from Illumina:
    s_7_1_sequence.txt
    s_7_2_sequence.txt

    How can I change them into BFAST.fq file.

    Here is the ill2fastq.pl comment:

    ill2fastq.pl [[ -b <bar code length> | -B ] -n <number of reads> -o <output prefix> -q -s] <input prefix>

    But dont know what -q -s stand for.



    For single mapping, do I still need to do any format change by this script?


    Thanks,
  • nilshomer
    Nils Homer
    • Nov 2008
    • 1283

    #2
    Originally posted by tanghz View Post
    Hi have a set of data from Illumina:
    s_7_1_sequence.txt
    s_7_2_sequence.txt

    How can I change them into BFAST.fq file.

    Here is the ill2fastq.pl comment:

    ill2fastq.pl [[ -b <bar code length> | -B ] -n <number of reads> -o <output prefix> -q -s] <input prefix>

    But dont know what -q -s stand for.



    For single mapping, do I still need to do any format change by this script?


    Thanks,
    I have added a description to the latest GIT commit. It is as follows:
    Code:
    The -q option specifies that qseq.txt files are expected, while 
    the -s option specifies that sequence.txt files are expected.
    Thank-you for finding these undocumented options.

    Comment

    • tanghz
      Junior Member
      • Sep 2010
      • 3

      #3
      Thank you for the clarification,
      I have done it.

      Could you also clarify if I need to transform the sequence.txt file into fastq by your script?
      Can I use the sequence firectly?

      thanks
      Last edited by tanghz; 09-15-2010, 01:07 PM.

      Comment

      • nilshomer
        Nils Homer
        • Nov 2008
        • 1283

        #4
        Originally posted by tanghz View Post
        Thank you for the clarification,
        I have done it.

        Could you also clarify if I need to transform the sequence.txt file into fastq by your script?
        Can I use the sequence firectly?

        thanks
        You will have to convert your input files to the FASTQ format if they are not in that format already.

        Comment

        • tanghz
          Junior Member
          • Sep 2010
          • 3

          #5
          Hi , I am using your readgenerate scripts, vert handy. However, I notice the ID of paired read is the same as the first one. e.g.
          @readNum=1_strand=+_contig=17_pos=30714265_numends=2_pel=0_rl=36_wrv=1_si=-1_il=0_r1=000000000000000000000000000000000000_r2=0000000000000000000000
          00000020020000
          GCTCTGAGTATCAGACACACCGTGGCCTCCCCAAGG
          +
          ::::::::::::::::::::::::::::::::::::
          @readNum=1_strand=+_contig=17_pos=30714265_numends=2_pel=0_rl=36_wrv=1_si=-1_il=0_r1=000000000000000000000000000000000000_r2=0000000000000000000000
          00000020020000
          GGCCAAAGGGACACCGGTTTGACAACCAACAGCGTG
          +
          ::::::::::::::::::::::::::::::::::::




          There is no reads space info. Did I do sth wrong? How do I parse the second read coordinates for later verification?
          thanks.
          Last edited by tanghz; 09-20-2010, 08:36 AM.

          Comment

          • nilshomer
            Nils Homer
            • Nov 2008
            • 1283

            #6
            Originally posted by tanghz View Post
            Hi , I am using your readgenerate scripts, vert handy. However, I notice the ID of paired read is the same as the first one. e.g.
            @readNum=1_strand=+_contig=17_pos=30714265_numends=2_pel=0_rl=36_wrv=1_si=-1_il=0_r1=000000000000000000000000000000000000_r2=0000000000000000000000
            00000020020000
            GCTCTGAGTATCAGACACACCGTGGCCTCCCCAAGG
            +
            ::::::::::::::::::::::::::::::::::::
            @readNum=1_strand=+_contig=17_pos=30714265_numends=2_pel=0_rl=36_wrv=1_si=-1_il=0_r1=000000000000000000000000000000000000_r2=0000000000000000000000
            00000020020000
            GGCCAAAGGGACACCGGTTTGACAACCAACAGCGTG
            +
            ::::::::::::::::::::::::::::::::::::




            There is no reads space info. Did I do sth wrong? How do I parse the second read coordinates for later verification?
            thanks.
            Feel free to dig into the code on this one as I am not supporting that read simulator very heavily; I would be happy to incorporate a patch though,. Otherwise, I would recommend the "dwgsim" tool within http://dnaa.sf.net. The latter is something I am supporting and actively maintaining.

            Comment

            • Jenzo
              Member
              • Mar 2011
              • 31

              #7
              Dear nilshomer,
              thanks for your easy-to-use ill2fastq.pl script. Since I'm working on a huge dataset and need to convert from Illumina 1.3+ to fastq I used this script and it worked well the first 20GB, then I got the following error:

              C:\path-to-file>perl ill2fastq.pl -s my_sequences > C:\path-to-file\file.fastq
              ON 0
              ON 1
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_on
              e> line 4.
              Unicode character 0xfffffffffffffffe is illegal at ill2fastq.pl line 383, <FH_on
              e> line 4.
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_on
              e> line 4.
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_on
              e> line 4.
              Unicode character 0xfffffffffffffffe is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Unicode character 0xfffffffffffffffe is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Unicode character 0xfffffffffffffffe is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Unicode character 0xffffffffffffffff is illegal at ill2fastq.pl line 383, <FH_tw
              o> line 4.
              Malformed UTF-8 character (byte 0xff) in reverse at ill2fastq.pl line 397, <FH_t
              wo> line 4.
              vw'ε\ê↔█P@▌╚*⌂┴╤§Φ╒E▬ª↔_påZ(*ijJ┼⌂■{x⌂√■∩┐▓╖¢█╒7ⁿw²mu╡┌ⁿ╧╒*¡■U¶y^╥OVΣY^µYYû┘«,v♣
              ╛╦±Qαë▌ƒ╟┐■≈+╔╬╣εαú≈▒∩¢╛∩█╢∩╦≥☺▲╒cU5╧mk£i█√≡τ±»*$$▀▌▐É`╘½(Q╣,+±☺OE╢╦╦▌p→.ªX«▓
              ╢"uL ♥mysequences_2_sequence.txt ┤}█VδJ¼σ√∙ì~∞╤ú !↨╓╙1▲º}6ù►áê‼▀]σ*∩**é╓¡
              £└r♣♫8¼═Z►╪→èóƪñ⌐╩⌂■w·■÷╧*∙»Φm╛ܲ┴?╫⌂fW│┼*║·┐╫*◄G¢▼⌂ⁿ╟*>'╣║√∙╟⌂ⁿτêΣ⌡jNé‼5▒╩^≡/¶
              ▲╫xy+→'‼k∞♣7Sk<╗║a╖ê'╓╪♂╓zjìg7δ♂⌐∞%Oε╔½╡∟╛⌐=┘♂.⌂ß↑πV^,û$9ÜZσA▓■àÖGu^▄,.s·╝α║₧Xπ¢
              ò↑yjì╜αë5₧├▒^]$Å£H■╣╞A¥%zF╙δ|{æL☻Æτ╫╖↨╥┘Kn&≈ìkë∙‼▼└‼╔ô█y╣\\╞╠^≡─↓{■τz=╗♦*:
              Died at ill2fastq.pl line 229.
              I tried to figure out, what happened here, but was only suggest that the problem lies in perls encoding of strings? (http://jeremy.zawodny.com/blog/archives/010546.html and http://perldoc.perl.org/perldiag.htm...ter-%28%25s%29)
              Perhaps someone has an idea or can provide a fast script to do the conversion fast and correct! Thanks a lot! Yours Jenzo

              Comment

              • kellywilliams
                Junior Member
                • Oct 2010
                • 8

                #8
                ill2fastq.pl failed

                Hi,

                I am having difficulty using ill2fastq.pl. I have successfully used BFAST for alignment of all of my SOLiD data, but cannot get step 1 to work for my Illumina data. I am using bfast-0.6.4e

                This is what happens when I try to run the perl script (my two files are names 100247_1_sequence.txt and 100247_2_sequence.txt):

                Code:
                $ perl ill2fastq.pl -s 100247
                ON 0
                Malformed UTF-8 character (byte 0xff) in reverse at ill2fastq.pl line 395, <FH_two> line 4.
                @HWUSI-E@HWUSI-EAS570R_0028:6:1:1311:1079#0/2
                Died at ill2fastq.pl line 227
                .

                If you can help me out that would be great! Thanks in advance,

                Kelly

                Comment

                • nilshomer
                  Nils Homer
                  • Nov 2008
                  • 1283

                  #9
                  Googling "Malformed UTF-8 character" there seems to be something wrong with your encoding. What is your platform/OS?

                  Comment

                  • kellywilliams
                    Junior Member
                    • Oct 2010
                    • 8

                    #10
                    Originally posted by nilshomer View Post
                    Googling "Malformed UTF-8 character" there seems to be something wrong with your encoding. What is your platform/OS?
                    I have a 64-bit linux running RedHat. I just tried it again using bfast-0.6.5a and the same thing happened.

                    Comment

                    • nilshomer
                      Nils Homer
                      • Nov 2008
                      • 1283

                      #11
                      Can you try on a different machine?

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      19 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      16 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-23-2026, 11:41 AM
                      0 responses
                      16 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-20-2026, 11:10 AM
                      0 responses
                      26 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...