Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • qc.share
    Junior Member
    • Sep 2010
    • 3

    Help:how to extrcate information from the output file of Novoalign mapping tools

    Hello, Everyone,
    I want to extrcate some information from the output file of NonoAlign mapping tool, the output file format is FASTQ format, it likes this:
    @HWUSI-EAS1522 100625:1:1:1290:9446 # 0/1
    CGTCTCGTCTCGTCTCGTCTCGTCTCGTCTCGTCTA
    ################################ QC

    I have 2 questions:
    *The first question is what's the detail meaning of number in the first line (HWUSI-EAS1522 100625:1:1:1290:9446 # 0/1)?

    * The other question is how can I get the tab-separated files without headers containing four coulumns( 1 chr of reads; 2 the start position of the mapped read; 3 the stop position of the mapped read; 4 the strand information) which were extrcated from the output files of NovoAlign mapping tools.

    Thank you very much!

    qc.share
  • svl
    Member
    • Sep 2009
    • 43

    #2
    Originally posted by qc.share View Post
    the output file format is FASTQ format
    Are you sure this is not the input format? I've never used Novoalign, but when mapping you normally use fastq as input and SAM/BAM as output (as is stated on the novoalign website as well...) A SAM/BAM holds mapping information such as your requested parameters, the fastq obviously doesn't.

    what's the detail meaning of number in the first line
    This is information about the the generated read such as machine, run, flowcell, lane, tile and paired-end/single-end.

    how can I get the tab-separated files without headers containing four coulumns
    SAM output will contain such information.

    Comment

    • qc.share
      Junior Member
      • Sep 2010
      • 3

      #3
      Thank you very much!

      Originally posted by svl View Post
      Are you sure this is not the input format? I've never used Novoalign, but when mapping you normally use fastq as input and SAM/BAM as output (as is stated on the novoalign website as well...) A SAM/BAM holds mapping information such as your requested parameters, the fastq obviously doesn't.


      This is information about the the generated read such as machine, run, flowcell, lane, tile and paired-end/single-end.


      SAM output will contain such information.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 12:17 PM
      0 responses
      4 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, Yesterday, 11:41 AM
      0 responses
      10 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      37 views
      0 reactions
      Last Post SEQadmin2  
      Working...