Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • scami
    Member
    • Sep 2010
    • 55

    soap segmentation fault

    Hi Guys

    I am using soap aligner on fastaq files and I get a "segmentation fault" at the end of the process. The input files have been created by myself with a script that extracted the reads from an old alignment file and, for this reason I suspect that there may be some problem with them although at a first sight they look ok. The command I used is inside a file called "go" and is the following

    Code:
    ./soap -D ./index/genome.fasta.index -a exp_47_s_A1.fastq  -b exp_47_s_A2.fastq -o paired_mapped_v2g3r1_1 -u unpaired_v2g3r1_1 -2 single_mapped_v2g3r1_1 -v 2 -g 3 -m 50 -x 400 -r 1 -t  -p 14

    I get the following output:

    Code:
    Begin Program SOAPaligner/soap2
    Wed Sep 29 15:34:14 2010
    Reference: ./index/genome.fasta.index
    Query File a: exp_47_s_A1.fastq
    Query File b: exp_47_s_A2.fastq
    Output File: paired_mapped_v2g3r1_1
                 single_mapped_v2g3r1_1
                 unpaired_v2g3r1_1
    Load Index Table ...
    lsLoad Index Table OK
    Begin Alignment ...
     131072 ok    3.36 sec
    ..................................
    ..................................
    24510464 ok    3.96 sec
    24641536 ok    3.73 sec
    24772608 ok    3.79 sec
    24903680 ok    3.63 sec
    25034752 ok    3.86 sec
    ./go: line 1: 25344 Segmentation fault
    the last lines of my input files are
    Code:
    tail exp_47_s_A1.fastq 
    +ILLUMINA-C3C24B_0047:1:120:18879:21119#0/1
    abb\bb_]__]]]]]KKDOOWZWWWbbabbbbbbbbbbbbb_bbbOODDOOONNNb\bbba`]Xa`Ya^``_[bb
    @ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1
    agcagatcatgtggtganggactcggctggtcacagtcaggctgtgagccgatggtttgcccctcccccagggat
    +ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1
    bbbbbbbbbbbbbbb``F^`aaaaabbbbb_ba`baab_a``_`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    @ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1
    CTTGAAAACCTAGAATCAACACAAAATGAAAAAAAAAAAAAGCCCAAAAAAATGGCTTCCAAACCAGAAAactga
    +ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1
    bbbbbbbbbbbbabbbabb_bbbbbbbbbbbbbb______ZL_[]`_`__b]Y\`]\\`O^]]W^bVb]bBBBBB
    
    
    
    tail exp_47_s_A2.fastq 
    +ILLUMINA-C3C24B_0047:1:120:18879:21119#0/2
    bb^bbbbbbbabbbbS^W[^bbb_bbbbbbVUFZVOIKKO[ZVXWLTWWTT^^^[]RRR__BBBBBBBBBBBBBB
    @ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2
    GTATTATCTACTGTGAGAGGAGTTGAGATCCGATTGAGTCCCGAGAGTATCTgtcgcattctcgacatcccttcg
    +ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2
    bbbbbbbbbbbbbbbbbbbbbbbbb_bbbbabbbbbbbc`c__ababab^U^BBBBBBBBBBBBBBBBBBBBBBB
    @ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2
    CAAATATGCAGCTCAAATGTCATCCCTGCATGCTCTAATACCAATTGATGAACTTTTAaacgacataggatcaca
    +ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2
    bbbbb`bbbbbbbbbbbbb_bbbbbbbbbb_b^]b`abb^bbb`aaa`^`aaU]^^a_BBBBBBBBBBBBBBBBB

    It looks everything right to me...... any idea?

    thanks a lot for helping
  • cwisch88
    Member
    • Jan 2012
    • 15

    #2
    Did you ever find an answer to this? I'm having the exact same problem!

    Comment

    • scami
      Member
      • Sep 2010
      • 55

      #3
      No unfortunatly! i used bwa for my alignments, which is quite good and fast. i read great things also about bowtie2 that has been recently released. i will soon give it a try. Good luck!

      Comment

      • cwisch88
        Member
        • Jan 2012
        • 15

        #4
        Okay well let me get the full story here.

        What does the command "go" do? Are these reads that you suspect to be the problem?

        From what I can tell, when this happens to me I get a number like 1310720 ok X.XX sec. and then I receive the segmentation fault.

        So far I have deduced that the number represents how many read pairs that it has processed before failing.

        Now, it only reports that the alignments are okay for each batch of 131072, so if I take out that block of reads, it continues until it hit something else!

        I'm thinking it might be a q-score problem, but I'm having trouble wrapping my mind around the standards:

        FASTQ formats

        Comment

        • scami
          Member
          • Sep 2010
          • 55

          #5
          Hi there,

          so let me get this clear. When you write:

          Now, it only reports that the alignments are okay for each batch of 131072, so if I take out that block of reads, it continues until it hit something else!


          you mean that you cut the file containing the reads starting from line 131072 and until the end? And you got the same error?

          Generally the "segmentation default" error happens (at least in C and C++) when one of the following problems occur (among other):
          1) the software is trying to open a file that does not exist. This is not our case since all the files are recognised and open
          2) the available memory is not sufficient for the process to terminate
          3) Some variable is used to store a value that is retrieved from a file but for some reason the retrieved value is too big to fit in the amount of memory available for that variable.

          If all the reads are ok then point 3 should not happen. In order to verify that point 2 is not happening I would split the file containing the reads in sub-files 131072 line long, launch the alignment and see whether the software fails again.

          let me know whether this suggestion has been of any help

          Comment

          • cwisch88
            Member
            • Jan 2012
            • 15

            #6
            A FASTQ has 4 lines per read. When it segfaults at 25034752 it means that it has gone through 12517376 reads from reads_1 and 12517376 from reads 2. And something in the next 131072 reads makes it choke. At least that is what I think I am getting from the evidence here.

            When I removed the first chunk it did continue further than it had before and then dropped out again.

            I thought it was a memory issue, but then I saw it was failing in the same place no matter how much memory I threw at it.

            Luckily, I think I have a small dataset that chokes on this. I will try the idea of separating it into files 65536 from each of the reads files and seeing if there is something there.

            Now I'm really new to soapaligner and I'm not familiar with all of the options, so it is not out of the realm of possibility that my problem could be a max size of insert problem.

            Could it be that soapaligner expects a certain insert size and if those qualifications aren't met it can segfault (point 3)?

            I hope I have more helpful info today.

            Comment

            • cwisch88
              Member
              • Jan 2012
              • 15

              #7
              This morning has been productive so far, it seems the removal of the -g allows the alignment to go through. So I'm wondering if my original allowed gap (6bps) is too large? I guess I'll keep chronicling things until I solve this headache.
              Last edited by cwisch88; 04-18-2012, 06:56 AM.

              Comment

              Latest Articles

              Collapse

              • mylaser
                Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by mylaser
                Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                This guide explains everything you need to know about...
                Yesterday, 01:13 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-09-2026, 10:04 AM
              0 responses
              19 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-08-2026, 10:08 AM
              0 responses
              11 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              28 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Working...