Is there any one using FASTX? It need fastq int format. Do you know how to convert general fastq into fastq int? Many thanks for any suggestion.
Unconfigured Ad
Collapse
X
-
You're not talking about Bill Pearson's tool FASTX, see Pearson et al (1997). Comparison of DNA sequences with protein sequences.
The FASTA package of sequence comparison programs has been expanded to include FASTX and FASTY, which compare a DNA sequence to a protein sequence database, translating the DNA sequence in three frames and aligning the translated DNA sequence to each sequence in the protein database, allowing gaps a …
You probably aren't talking about the FASTX-Toolkit either, since that supports multiple FASTQ variants.
What are you talking about?
-
The FASTX-Toolkit can read standard FASTQ files with ASCII qualities
Could you tell us the command line you are trying to use that fails, and show us the first few reads of your FASTQ file (using the [ code ] and [ /code ] tags in the forum, or the # button on the advanced editor).
Comment
-
Hi, I did
$ ./fastq_quality_trimmer -t 20 -l 30 -i sra_data.fastq -o sra_data.fastq.quality.trimmed
fastq_quality_trimmer: Invalid quality score value (char '*' ord 42 quality value -22) on line 12
the fist 12 lines of reads
@SRR001030.1.1 Hela.tar.gz:8:1:328:133.1 length=27
TCGAGATTTCTACAGTCCTTCGATAAC
+SRR001030.1.1 Hela.tar.gz:8:1:328:133.1 length=27
IIIIIIIIIII8IIIIIIIIIIIII4I
@SRR001030.2.1 Hela.tar.gz:8:1:96:66.1 length=27
ATGTACGGTAAATGGAAAAAAAAAAAA
+SRR001030.2.1 Hela.tar.gz:8:1:96:66.1 length=27
IIIIIIIIIIIIIIIIIIIIIIIIIII
@SRR001030.3.1 Hela.tar.gz:8:1:400:280.1 length=27
TCGGATGCCTACTTCTGCTTGAAAACA
+SRR001030.3.1 Hela.tar.gz:8:1:400:280.1 length=27
IIIIIIIIIIIIIII*&IIIIII/III
Any suggestion?
Comment
-
Are you using an older version of the toolkit? The files you showed are valid FastQ and use the Sanger encoding method. The FastX download page shows that automatic encoding detection was introduced in v0.0.13 so if you're using a version which is older than that it might be assuming an Illumina encoding.
Comment
-
I think as Simon suggests your (old) version of FASTX-toolkit is probably assuming you have Solexa/Illumina FASTQ (which have a narrow range of allowed characters), but you have Sanger FASTQ. Try the FASTX command line option -Q 33 here.
Comment
-
i'm running into the same problem. I just got read off an Illumina GAIIx. Here are the first few lines:
@GEN-SEQ-ANA_0012:2:1:1562:1167#0/1
GAATACGTTCGCGTCACACAGTATCAACGGAAGCGGGTAAATGAAGGCGACACAGGGGATAAGCAGGGTTTCATGAAGTATCTTGGGCACGTGCCAGCGAG
+
A;-A4=B:?0?2?########################################################################################
@GEN-SEQ-ANA_0012:2:1:1626:1169#0/1
GAGGAAGGCGGTTTTGAAGGAGAGGGGAGGCTTTCGGACCAAGGGAAGGAAGGGAGGGTAAGAAAAGGAAAAAGAATTTGTGAGGGAGAAGGGTTTTTATC
+
D@EB:?DD;BF=EEEE>@BB4A;BAA;';;/??88AA################################################################
@GEN-SEQ-ANA_0012:2:1:1959:1166#0/1
GTGAGGGGATGTTCACTAGCTTGCCTACTTCGTCGAAGATCAGCTTGGCCTGGGTATTCGCGGTCCCTGCTGTTTTAAAGTTGGCGCCTGCTGCGTCCGCT
+
@6@)@B@<(?EBDBEBGBDB?B8BE?8,B0:A#####################################################################
When I try to run:
gunzip -dc s_2_reads_passed_filter.fastq.gz | fastx_quality_stats
I get the error
fastx_quality_stats: Invalid quality score value (char '-' ord 45 quality value -19) on line 4
I'm running the latest version:
[golharam@vail input]$ fastx_quality_stats -h
usage: fastx_quality_stats [-h] [-N] [-i INFILE] [-o OUTFILE]
Part of FASTX Toolkit 0.0.13 by A. Gordon ([email protected])
Comment
-
Have you tried the solution discussed above? This tells FASTX to treat the qualities as Sanger FASTQ...
gunzip -dc s_2_reads_passed_filter.fastq.gz | fastx_quality_stats -Q 33
Are you sure your FASTQ files are in the original form from your Illumina GAIIx? Do you know what version of the pipeline it was?
Comment
-
The long strings of # are a give away that this FASTQ is encoded in the standard Sanger format (Phred + 33). '#' is ASCII 35; if this was still Illumina format (Phred + 64) these would be 'B' which is the tell tale Illumina Quality Control Indicator.
Do as maubp and others have suggested and add the -Q33 option to your fastx command.
In feng and golharam's defense the -Q parameter to the fastx commands is not documented and does not appear in the help message. It is only discoverable by reading the source code (or the very helpful replies on SeqAnswers). The authors of the fastx toolkit could really help by documenting this option.
Comment
-
The -Q option is on http://hannonlab.cshl.edu/fastx_toolkit/ as part of a release announcement, but otherwise I agree with you.Originally posted by kmcarr View PostIn feng and golharam's defense the -Q parameter to the fastx commands is not documented and does not appear in the help message. It is only discoverable by reading the source code (or the very helpful replies on SeqAnswers). The authors of the fastx toolkit could really help by documenting this option.
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 08-06-2026, 07:41 AM
|
0 responses
14 views
0 reactions
|
Last Post
by SEQadmin2
08-06-2026, 07:41 AM
|
||
|
Started by SEQadmin2, 08-03-2026, 10:13 AM
|
0 responses
31 views
0 reactions
|
Last Post
by SEQadmin2
08-03-2026, 10:13 AM
|
||
|
Started by SEQadmin2, 07-31-2026, 02:55 AM
|
0 responses
40 views
0 reactions
|
Last Post
by SEQadmin2
07-31-2026, 02:55 AM
|
||
|
Started by SEQadmin2, 07-24-2026, 12:17 PM
|
0 responses
26 views
0 reactions
|
Last Post
by SEQadmin2
07-24-2026, 12:17 PM
|
Comment