Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • gfmgfm
    Member
    • Jun 2010
    • 64

    how to extract unique hits from a sam file

    I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome.
    I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by :

    samtools view -bq 1 aln.bam > aln-reliable.bam

    Download SAM tools for free. SAM (Sequence Alignment/Map) is a flexible generic format for storing nucleotide sequence alignment. SAMtools provide efficient utilities on manipulating alignments in the SAM format.


    However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it.

    How can one do it?
  • drio
    Senior Member
    • Oct 2008
    • 323

    #2
    Take a look to this thread.

    I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to
    filter uniquely mapped:

    Code:
    $ samtools view bwa.bam | grep "XT:A:U"
    -drd

    Comment

    • gfmgfm
      Member
      • Jun 2010
      • 64

      #3
      Thanks a lot!

      Comment

      • seq_GA
        Senior Member
        • Feb 2009
        • 124

        #4
        Hi,
        I am also looking for such solution. But in my bam file, I don't see any
        Code:
        XT:A:U
        instead its a SOLEXA single read where I have converted export to sam format as below.



        Code:
        test_1:8:69:19633:9434       0       chr10   5423197 4       45M     *       0       0       CACACAACCCCCACACCAAACACACACCCCCCACACACAACAAAC      0.2B90+)*=@8@################################   XD:Z:6C11C15G4CACT2     SM:i:4
        test_1:8:56:11474:20981      0       chr10   7323903 6       45M     *       0       0       ATCAAGCGATCCTCCCACCTCATCCCCCTAAGTACCTGTGACTAA      757@54;3;1@@@@@22@###########################   XD:Z:22G11G3G5C SM:i:6
        Any generic way of picking unique hits from sam file? Thanks.

        Comment

        • gfmgfm
          Member
          • Jun 2010
          • 64

          #5
          I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?).

          Maybe you would like to use the _sorted file from the Illumina pipeline:
          the desciption of the _sorted file- from CASAVA 1.7 manual p. 73:
          This output file is similar to s_N_export.txt, except it contains
          only entries for reads which pass purity filtering and have a
          unique alignment in the reference. These are sorted by order
          of their alignment position, which is meant to facilitate the
          extraction of ranges of reads for purposes of visualization or
          SNP calling.
          These files are only produced if the flag WITH_SORTED is
          used."

          Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

          Comment

          • emp
            Member
            • Jan 2014
            • 11

            #6
            hello all,
            I have Illumina data, which I mapped through Bowtie2 and got a sam file.

            Now I need to extract the reads which are being shown uniquely one time.

            Kindly guide if something could be done for that.

            I have tried a bit of commands for the above, but failed to get those reads separated.

            Kindly guide ASAP.

            Comment

            • Wallysb01
              Senior Member
              • Feb 2011
              • 286

              #7
              Originally posted by emp View Post
              hello all,
              I have Illumina data, which I mapped through Bowtie2 and got a sam file.

              Now I need to extract the reads which are being shown uniquely one time.

              Kindly guide if something could be done for that.

              I have tried a bit of commands for the above, but failed to get those reads separated.

              Kindly guide ASAP.
              How about just use bowtie with the -m 1 option set?

              Comment

              • emp
                Member
                • Jan 2014
                • 11

                #8
                hello Wallysb01,

                after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out.

                thanku for the same.

                Comment

                • dpryan
                  Devon Ryan
                  • Jul 2011
                  • 3478

                  #9
                  Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    07-08-2026, 05:17 AM
                  • GATTACAT
                    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                    by GATTACAT
                    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                    07-01-2026, 11:43 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, Yesterday, 10:26 AM
                  0 responses
                  11 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-09-2026, 10:04 AM
                  0 responses
                  25 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-08-2026, 10:08 AM
                  0 responses
                  16 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-07-2026, 11:05 AM
                  0 responses
                  33 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...