Bowtie and reads that failed to align: (100.00%)

[michy]

Hello,
Can someone help me please. I have some new paired-end sequence from illumina and the reads are not aligning. What am I doing wrong? An example of the reads are below with the commandline I am using. I would be grateful for any help, cheers.

Read from sequence file #1
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
GCTCCAGTATAGGGGAATGCCAGGACTAGGAAGAGGGATTGTGTGGTTTGGAGAGCAGGACGGAGGGAGGGTATACGTCACTATGAGATGGGAAACTTGTA
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
ccccc_ca\c[[]X]JYJVRRHSXHMMNYVPVZEIWFFYXXZ_Z]cbccb_J[G_VPZUF^X`H`^YD`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HISEQ2000_0110:4:68:14861:199831#GCACTG/1


Read from sequence file #2
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
CACTTTAAAATCTATTTGATCTTGAGGAAATCAGTTGTGTTTCCTAGTTATATAGTCTATCATTTAATAATAGCACTAATGAAGTGTTTAGAAGTAATAAT
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
ggggggggggfbfIffffefggggeggggeU^cf_eedfee^ZZ\accdd]eeeeffedfI[bbbcYccbeaeddgggaedTcc_dbfdIc\c\P_ZM_BB


Commandline
./bowtie -t -p 14 -q -I 0 -X 300 -S --chunkmbs 2048 mus -1 ../working/s_temp_1.txt -2 ../working/s_temp_2.txt ../working/s_temp_aligned.sam

[fkrueger]

Hi michy,

The command you used looks ok-ish, but

(a) -q is the default, however Bowtie will then assume Phred33 qualities. The HiSeq seems to chuck out Phred64 encoded data though, try specifiying -q --phred64-quals
(b) -I 0 is not not required as it is the default
(c) If you still don't get any alignments you might want to increase -X to a higher value, maybe your insert sizes are just larger than 300bp?

Hope (a) or (c) will fix it.

[michy]

Hello fkrueger,
thank you for your reply. Your suggestions esp. a) and c) they did improve the alignment by 15% which means 85% still failed to align. However, I was testing the command on a small subset of the data. I will try some more reads and get back to you.

Thank you again and any other suggestions welcome.

Michy

[fkrueger]

May I ask if you used FastQC on your sequence files to find out whether you are sequencing into the adapter on the other side? This might throw mapping efficiencies off quite a bit and can be fixed by trimming adapter sequences off or just shortening the sequences a bit.

[michy]

Hello fkrueger,
I've never tried this software but I will now, it looks very useful.

Thank you,
Michy

[andrehorta]

I used the command: bowtie -p 4 /rs4244385A

And reads that failed to align: (100.00%)

Can help me?

[andrehorta]

Help!

I used the command: bowtie -p 4 /rs4244385A

And reads that failed to align: (100.00%)

Can help me?

anyone?????

[swbarnes2]

Your first read has lousy quality scores, and its best blast to mouse has several discrepancies. That's why it won't align. The second read should align fine.

rs4244385 is a human SNP.