Does anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?
Unconfigured Ad
Collapse
X
-
I have same question.
Originally posted by seqgirl123 View PostHi,
I am a little confused with the various schematics I found on the Solexa adapter structure.
I followed Illumina's pdf (attached) and made the forked structure myself (jpeg). I also listed the variations I saw on the right taken from various schematics people have posted on this website which I think they took from other journal articles.
Can someone tell me if the sequences taken from Illumina's pdf are the correct forked structures as I've drawn them, meaning is that the way they're really supposed to look? My version has more bases ligating to each other versus the ones taken from this website which have fewer, why is that and does it make a difference? Thanks.
Comment
-
In an Illumina webinar yesterday it was stated that they are equivalent to 'complete adapters' ie., they have the extension which is normally added during the library amplification that allows the library material to anneal to the Flowcell. Thus if you start with enough material you could potentially skip the Library amplification step.Originally posted by SeqTruth View PostDoes anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?
See paper below for discussion of 'complete adapters'
Nature Methods 6, 291 - 295 (2009) Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes
Comment
-
You have to ask Illumina for them. I posted a pdf of them but Illumina made this site take them down.
Comment
-
Originally posted by NextGenSeq View PostYou have to ask Illumina for them. I posted a pdf of them but Illumina made this site take them down.Really? You were actually told by Illumina to remove them? Why would they care? It was sent to me out of the blue by Illumina staff, I didn't request it. They told me to feel free to distribute it.Originally posted by ECO View PostHi guys/ScottC,
NextGenSeq is correct, ILMN does not want the TruSeq adapter sequences published here.
Apologies...
You're certainly allowed to publish 'individual sequences'...
"For individual sequences contained in this letter, lllumina grants you permission to distribute them outside your institution, or publish individual sequences in presentations, manuscripts, or publications authored by you, as long as it is accompanied by the following copyright notice:
Oligonucleotide sequences © 2007‐2011 Illumina, Inc. All rights reserved."
Comment
-
Yup. In this thread when they were posted initially, I received a very nice email from their Senior Patent Counsel. Post#4 in that thread has the statement ILMN asked me to include with the takedown.
I hadn't seen that release above...the original posting did have that copyright attached as I remember.
Comment
-
Ok, so somebody can maybe post those pdfs on a website somewhere, with some obvious search terms associated, and anyone with access to Google can find and download them; a minor inconvenience for now.
For those of us who already have the pdf with all the TruSeq sequences, it would be nice if someone could clarify the question of library amplification PCR primers for the TruSeq DNA and RNA sample prep kits...?
Comment
-
Does anyone have a schematic illustration (similar to what kmcarr has posted in this thread for SE and PE library construction and sequencing) when using Illumina's multiplex kits for library construction and sequencing. So far, I have seen the single end and paired end library construction and sequencing illustrations and they have been great learning tools for a lot of us here. Can someone post the same schematic for the multiplex library construction and sequencing?
In Illumina's version of multiplexing, they have a multiplex adapter, multiplex PCR primers, and a separate PCR index primer (3 PCR primers in all). The newer TruSeq kits brought this down to only 2 PCR primers in all, so there is only a multiplex adapter and the multiplex PCR primers (the index sequence is contained in the multiplex PCR primer I think is how it works). So I'm really looking for a schematic on Illumina's original multiplex kit and would much appreciate if someone can post their multiplex illustration here.
Comment
-
40% adaptor sequence
Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!
I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?
Thanks!
Comment
-
Size selection is your problem step. The adapters will form a product after PCR of ~124bp. If you size-select your library on a gel you are certainly cutting out your block of DNA-embedded agarose too close to where the adapters run. To avoid this run your library on a long gel and at low voltage, in a cold room is even better (according to Illumina). This should give you better separation of your library from the free adapters.Originally posted by lizhen View PostThanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!
I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?
Thanks!
But, if you have access to a Pippin Prep instrument that will be even better. It will electro-elute your desired size range. It's a much cleaner method.
I've actually abandoned the Pippin and size-select after PCR. I do all of my DNA clean up steps with Ampure XP beads and PCR amplify the library first, then size-select. I never get adapter contamination anymore (I didn't with the Pippin either but my new method is way faster, has greater yield, and is cheaper).
Also, you should always run your library on a Bioanalyzer 2100 before you sequence. You can always size-select your library again to remove the problematic adapter concatamer. Otherwise, without this important quality control step you just might be wasting sequencing depth and wasting money.
Comment
-
We've just started using the eGel system and it's a great piece of kit. Relatively cheap to buy and run, it's clean and quick (takes about 30 minutes from start to finish). Although it doesn't work well on TruSeq libraries which migrate at funny speeds in the gel.
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 11:17 AM
|
0 responses
8 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 11:17 AM
|
||
|
Started by SEQadmin2, 08-18-2026, 10:05 AM
|
0 responses
18 views
0 reactions
|
Last Post
by SEQadmin2
08-18-2026, 10:05 AM
|
||
|
Started by SEQadmin2, 08-13-2026, 12:22 PM
|
0 responses
40 views
0 reactions
|
Last Post
by SEQadmin2
08-13-2026, 12:22 PM
|
||
|
Started by SEQadmin2, 08-11-2026, 10:35 AM
|
0 responses
32 views
0 reactions
|
Last Post
by SEQadmin2
08-11-2026, 10:35 AM
|
Comment