Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • spark
    Junior Member
    • Mar 2009
    • 6

    #1

    Sam flags for bwa-aligned paired end reads with identical + / - strand coordinates

    I'm looking at some paired end WGS data from a library with very small insert sizes, meaning that many of the DNA fragments are sequenced fully in both directions.

    Reads were aligned to a template genome using BWA. For many reads, the insert size is zero (i.e. forward and reverse strand coordinates are identical) These reads are being flagged by bwa sampe as improperly paired (sam flags 81 & 161 or 97 & 145), whereas I think they should count as properly paired.

    My question is whether downstream tools (specifically GATK realignment and SNP calling) will exclude these reads, and if so what I would need to do to get round the problem. (One workaround solution would be to extract these improperly paired reads, trim an extra base from the 3' end, then realign.)

    As an example:
    HWUSI-EAS174:5:102:602:453#0 97 chr1 66904 15 22M = 66904 22 CCAGGAGGCAGCAGCAGTAGCC B@?AA=A@@=A><>=A94>==9
    HWUSI-EAS174:5:102:602:453#0 145 chr1 66904 15 22M = 66904 -22 CCAGGAGGCAGCAGCAGTAGCC B=6B4@A?69@9<B?;7=BABA


    Thanks,

    Stephen
    Last edited by spark; 03-09-2011, 01:55 PM. Reason: Changing title to something clearer

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
17 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
15 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-23-2026, 11:41 AM
0 responses
13 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-20-2026, 11:10 AM
0 responses
24 views
0 reactions
Last Post SEQadmin2  
Working...