Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • AdamB
    Member
    • Apr 2010
    • 43

    FindPeaks SeparateReads.jar error using GERALD/ELAND-generated files

    I'm trying to use FindPeaks with some data mapped in ELAND via GERALD. At the moment I'm stuck on using SeparateReads.jar. Below is a sample of the data from the input "s_X_sorted.txt" file:

    Code:
    HWI-EAS486	19	4	26	19288	17610	0	1	GCTTGTGTATCACTGGCGCAGCAGAGAGTCTGAGCATG	hhhhhhhhhghhhhhhfhfhcgdggcffchggfghfgh	chr10.fa		55	F	38131					
    HWI-EAS486	19	4	65	12362	19698	0	1	CTGGTTAGAACAGCTAGGCCCTTGGGCCTCACTGTACA	hhhhhhghhhhhhhhhghhhhhhhhgfhhhhhhhfhhh	chr10.fa		145	F	38131					
    HWI-EAS486	19	4	79	19730	5608	0	1	GCCAGCCTGGCAACTATCAGGCCACAAGGTGACATAAG	gggggggggdffc_fggggfc]ffWfcfadffffea_[	chr10.fa		309	F	19T18	88
    I read in another thread that I could specify the aligner as "elandext", but to no avail. I get the following error message from SeparateReads.jar:

    Code:
    Version: Initializing class Log_Buffer                        $Revision: 2530 $
    Version: Vancouver Short Read Analysis Package                4.0.16-dev.jars
    Version: Initializing class SeparateReads                     $Revision: 3125 $
    Version: Initializing class Generic_AlignRead_Iterator        $Revision: 3118 $
    Version: Initializing class ElandExtIterator                  $Revision: 2933 $
    Exception in thread "main" java.lang.StringIndexOutOfBoundsException: String index out of range: 38
    	at java.lang.StringBuffer.setCharAt(StringBuffer.java:210)
    	at src.lib.ioInterfaces.ElandExtUtilities.parse_mismatches(ElandExtUtilities.java:23)
    	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:213)
    	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:22)
    	at src.lib.ioInterfaces.Generic_AlignRead_Iterator.hasNext(Generic_AlignRead_Iterator.java:121)
    	at src.fileUtilities.SeparateReads.main(SeparateReads.java:70)
    Is this a problem with the input file? I can't find any specification for the eland/elandext inputs for FindPeaks anywhere.
  • apfejes
    Senior Member
    • Feb 2008
    • 236

    #2
    Hi Adam,

    This may be a little more technically challenging, but would you be willing to compile and run from source? I suspect that this problem has been solved in the latest version, which has not yet been released.

    I can help walk you through the process, if you're unsure how to do that. If not, I can email you a compiled version.

    Anthony
    The more you know, the more you know you don't know. —Aristotle

    Comment

    • AdamB
      Member
      • Apr 2010
      • 43

      #3
      Hi Anthony,

      Yes I'd definitely like to try compiling the latest version. Is it on the website?

      Thanks

      Comment

      • apfejes
        Senior Member
        • Feb 2008
        • 236

        #4
        It's available from the svn repository. There are instructions here: http://sourceforge.net/apps/mediawik...=VSRAPBuilding

        use svn to get a copy of the source, and ant to build it (once you have ant and subversion installed)

        The more you know, the more you know you don't know. —Aristotle

        Comment

        • AdamB
          Member
          • Apr 2010
          • 43

          #5
          I can confirm the latest version (4.0.17) successfully separated my reads using the "elandext" flag.

          Thanks for your help.

          Comment

          • apfejes
            Senior Member
            • Feb 2008
            • 236

            #6
            Great, glad it's working!

            Anthony
            The more you know, the more you know you don't know. —Aristotle

            Comment

            • AdamB
              Member
              • Apr 2010
              • 43

              #7
              Small update: I tried to generate a wig file, which worked apart from that the chromosome name in the header was "chr1.fa". UCSC did not like this, so I changed the chromosome name to "chr1", and then it loaded okay. Do you know where the ".fa" part is coming from, and if it can be changed?

              Thanks.

              Comment

              • apfejes
                Senior Member
                • Feb 2008
                • 236

                #8
                That's coming directly from your file - the aligner is using the name of the file as the chromosome. (You can even see it in the snippet you gave at the top of the thread for chr10.fa)

                I seem to recall that there was a flag in FindPeaks to trim chromosome names and remove the .fa, but it escapes me what it would be. In the end, I think we just renamed all our .fa files to remove the extension and not have to worry about post processing our eland files.
                The more you know, the more you know you don't know. —Aristotle

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  Yesterday, 05:17 AM
                • GATTACAT
                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by GATTACAT
                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                  07-01-2026, 11:43 AM
                • SEQadmin2
                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by SEQadmin2


                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                  Here are nine questions we think about, in roughly the order they matter, before...
                  06-18-2026, 07:11 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Yesterday, 10:08 AM
                0 responses
                6 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-07-2026, 11:05 AM
                0 responses
                8 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-02-2026, 11:08 AM
                0 responses
                31 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 06-30-2026, 05:37 AM
                0 responses
                29 views
                0 reactions
                Last Post SEQadmin2  
                Working...