Small RNA Sample Prep v1.5.0

[jujuhi]

Hi all, does anyone already used new version 1.5. in small RNA sampling? Difference is in 3' adapter sequence that need to be pre-adenylated I guess, if T4 RNA ligase 2 will be used. Does anyone have sequence for this new adapter? That would be very handy....

[odelfour]

I'm also interested in people having already used this novel prep. kit.
It seems much easier and faster for seqeuncing one sample.
Does anyone already use it ?
How many reads do you obtain ? With which quality ?

best,

olivier

[Kameron]

Hi all,

im also interested in the sequence of this new adapter. Tomorrow i will start with the library preparation using the alternative v1.5 Protocol.
I am also planning a comparison of different input RNA (Total RNA and gel purified small RNA). I will report back.

[odelfour]

Hi Kameron,

Thank's for your contribution.

olivier

[Malabady]

hi,
The sequence of v1.5 3' small RNA adapter is
5'- ATCTCGTATGCCGTCTTCTGCTTG.
I tried the new protocol. Yes it is faster but it is not as accurate as the old one. Since there is no any gel purification step included until the last step, the target fragment is embedded in high background of degraded RNA. So it is not easy to excise especially when its faint band. I am planning to purify small RNA using denaturing Urea gel and then use this short protocol.....I will let you know

[davcast]

Hello,

Would anybody know the concentration of the v1.5 3' small RNA adapter either before or after 10X dilution?
Thanks for your reply

david

[dandestroy]

10µM before dilution

[jujuhi]

We also tried with enriched miRNAs after Novex gel. Did not work either... We got library but size more than 10 times smaller compared to old 1.0 kit. I also ran samples after ligations to Bioanalyzer and it seems to be that ligations in new kit do not work properly. Someone similar problems? Now we are using old kit with much better results but unfortunately more hands in time.

[odelfour]

Hi,
Which protocol did you use to extract total RNA ? seems that many small rna can be lost depending of the extraction protocole used.

And what is RNA quantity to you use with the 1.5 kit ?

I guess with the old one, you load at least 10 microg.

We also tried with enriched miRNAs after Novex gel. Did not work either... We got library but size more than 10 times smaller compared to old 1.0 kit. I also ran samples after ligations to Bioanalyzer and it seems to be that ligations in new kit do not work properly. Someone similar problems? Now we are using old kit with much better results but unfortunately more hands in time.

[jujuhi]

We have optimized that relatively lot and Trizol works the best in our hands. MiRVANA was the second best. According bioanalyzer we have plenty of miRNA in our samples. We have also sequenced same sample prepared by kit 1.0 and kit 1.5. Results showed that there were 75% less reads that align to genome in sample prepared by kit 1.5 .

We have also tried different starting RNA quantities in 1.5 kit. 1 and 10 µg without 15% Novex fragmentation and 10 µg with Novex (like in kit 1.0). There is no difference in library yield. The problem is in ligation I think. It seems to come a lot of adapter dimers compare to right size miRNAs.

Cheers, J

[zhangww]

Hi all, I used the new protocol with enriched miRNAs after Novex gel.For the plant samples, the results showed that

the 1.5 kit do not work properly. TA cloning was used to validate the library, and fewer miRNA would be found in it.

Anyone meet similar problems? Does the 3 adapter has some bias in the ligation of some others sequences (rRNA etc.)? I think the new protocol need to be improved.

We have optimized that relatively lot and Trizol works the best in our hands. MiRVANA was the second best. According bioanalyzer we have plenty of miRNA in our samples. We have also sequenced same sample prepared by kit 1.0 and kit 1.5. Results showed that there were 75% less reads that align to genome in sample prepared by kit 1.5 .

We have also tried different starting RNA quantities in 1.5 kit. 1 and 10 µg without 15% Novex fragmentation and 10 µg with Novex (like in kit 1.0). There is no difference in library yield. The problem is in ligation I think. It seems to come a lot of adapter dimers compare to right size miRNAs.

Cheers, J

[Rod]

v1.5 adaptors ligate without inserts

Hi all,

I'm preparing small RNA samples for v1.5 single end reads. After the cDNA library generation I've checked that the constructs contain each adaptor and an insert on a PAGE gel and see bands of the correct size (around 100nt). I have cloned the inserts into a plasmid and PCR amplified the construct from here and the size still looks good. However, when I Sanger sequence (for final validation) the cloned products I continually see the adaptors ligated together with no inserts. Has anybody else had this experience?

[davcast]

Hi Rod,
it seems you don't clone you small RNA. if you are following the illumina protocol, you often see two bands: one corresponding to the adapters dimers and up by 20-25 nt your cloned library. if you only see one band with the one step protocol (no gel purification after each ligation/RT), i doubt you successfully cloned your smalls.
Maybe check you have small RNA in you extract (on bioanalyzer).
good luck
david

[Marta]

The new v1.5 small RNA prep protocol seems to be working fine for me. I just finished analysis where I compared how many tags from the specific gene, and from tRNAs, rRNAs, and chloroplasts we got using the old and new protocols. Everything seems to be very similar. Do you have any other ideas how to evaluate the small RNA libraries?

[westlook]

hi,all

In some of our v1.5 Small RNA libraries,there are some strange sequences,most of which contain a sequence--" ATTTTGATTCCAACTTTTATCGTAAGGG ", It can match to Arabidopsis thaliana genome, and it even appeared largely in some anmial samples.How these sequence come out? Do you have any experiences or opions about it?

Thanks