illumina small RNA sample prep v1.5

[won337]

Hi guys-

Using the new illumina small RNA sample prep kit v1.5, do we expect an additional "A" right after the miRNA sequence?

Here is the original 3' RNA Adaptor sequence and result library and I added the red colored "A":
3' RNA Adapter
5' P-AUCGUAUGCCGUCUUCUGCUUGUidT
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATC (N) ATCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAG (N) TAGCATACGGCAGAAGACGAA C 5'


I suspect that illumina improved the new kit using pre–5',5'-adenylated adaptor, so the adaptor ligation can be performed in absence of ATP. However, I am not able to find such a reference. If you have one, please let me know.

Plus, are there any biases observed using this new kit?

[link1]

hi,
the 3' adapter sequence for small RNA sequencing, v1.5 is ATCTCGTATGCCGTCTTCTGCTTG. You'll need it to be 5'adenylated and 3'ddC blocked. You are right the 3' ligation does not require ATP and can be performed with T4 RNA Ligase 2, truncated.

I've tried to order this kit from Illumina but they are out of stock. I've been very happy with the small RNA Sequencing kit from Bioo Scientific. It includes all the components you need.

[cascoamarillo]

hi,
the 3' adapter sequence for small RNA sequencing, v1.5 is ATCTCGTATGCCGTCTTCTGCTTG. You'll need it to be 5'adenylated and 3'ddC blocked. You are right the 3' ligation does not require ATP and can be performed with T4 RNA Ligase 2, truncated.

I've tried to order this kit from Illumina but they are out of stock. I've been very happy with the small RNA Sequencing kit from Bioo Scientific. It includes all the components you need.

Ok, 3' adaptor with the 5'adenilated doesn't need ATP in the ligation reaction. But, what if you use a ligation buffer with ATP??

Thanks.

[Bioo Scientific]

Hi Cascoamarillo,

Using a buffer with ATP allows your small RNA insert to non-specifically bind to other small RNAs, and genomic material in your sample. By eliminating ATP in the 3’ligation step you ensure that your adenylated adapter is the only thing that’s ligating to your sample.

[silin284]

if u use ligation buffer with ATP, u will circulate all ur small RNA rather than ligating them to 3SR linkers. Because sRNA, at least in plants, have 5' PO4 and 3'OH. I thought the 3' linker is a DNA molecule with 5' App (adenylation). T4 RNL2 trun can't use a 5' phosphate.

[Bioo Scientific]

Hi Silin284,

The 3’ linker or adapter is an adenylated DNA oligonucleotide that will specifically bind to the OH groups of RNA when used in the presence of truncated T4 RNA Ligase. ATP in the reaction would cause a lot of non-specific binding.

[qubianka]

ligate 3' adapter

Does anyone use T4 RNA ligase instead mutated to ligate 3' adapter?

[Bioo Scientific]

Hi Quibianka,

We use T4 RNA Ligase (not truncated) to ligate the 5’adapter. /