Very Bad Mapping Results with several mapping softwares

[xquan]

I am new to NGS data analysis and trying to map my genome reads from Illumnia platform (paired-end reads, read length 100 and 150bp with insert length 350bp, and mate pair reads with read length 38bp and insert length 2kb and 5kb) to a reference genome (not the same specie, in the same family). I have tried to align these reads reference genome with BOWTIE, and BWA,).
No reads are mapped by BOWTIE at all with the following setting:
./bowtie REF --fr -I 320 -X 420 -q -1 GAIIx_150bp_1.fastq -2 GAIIx_150bp_2.fastq --fr -I 320 -X 420 -q -1 HiSeq_100bp_1.fastq -2 HiSeq_100bp_2.fastq --ff -I 1300 -X 3500 -q -1 HiSeq_s_1_1_QuaControled.fastq -2 HiSeq_s_1_2_QuaControled.fastq --ff -I 3300 -X 7600 -q -1 HiSeq_s_2_1_QuaControled.fastq -2 HiSeq_s_2_2_QuaControled.fastq -k 1 -m 1 -v 3 --al Palm_Hits_Bowtie --un Palm_NoHits_Bowtie Palm_Bowtie.sam -S --tryhard > bowtie.output


What's wrong with my setting?
I tried with BWA with one lane of 150bp reads as well using the default setting, I only got 0.26% percentage of reads being mapped with default setting, and 0.36% percentage of reads being mapped with the following command:
bwa aln -n 7 -o 3 REF.fsa GAIIx_s_1_1.fastq > GAIIx_s_1_1_bwa.sai
bwa aln -n 7 -o 3 REF.fsa GAIIx_s_1_2.fastq > GAIIx_s_1_2_bwa.sai
bwa sampe REF.fsa GAIIx_s_1_1_bwa.sai GAIIx_s_1_2_bwa.sai GAIIx_s_1_1.fastq GAIIx_s_1_2.fastq > GAIIx_s_1_bwa.sam.

All these reads have been under the following quality controls:
1. convert base quality phred(Q+64) score to phred(Q+33) score
2. Adapter trimming:
adapter sequence for read 1: GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG;
adapter sequence for read 2: ACACTCTTTCCCTACACGACGCTCTTCCGATCT;
sequence to trim from read 1: AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
sequence to trim from read 2: AGAAAGGGATGTGCTGCGAGAAGGCTAGA minimum adapter alignment length is set as 10;
base quality score threshold set as 20;
minimum length of read after adapter sequence trimming and qualtiy score filtering is set as 120 for GAIIx 150bp reads, 70 for HiSeq 100bp reads, and 30 for HiSeq 38bp reads.

Is it possible that my quality control went wrong?

Any help will be greatly appreciated

[xquan]

The query genome size (3Gb) is much larger than the reference genome (500mb). And reference genome is from de novo assembly contigs. But still mapped reads should not be so low.

[blackjimmy]

We've also met this question, except that our tag size was 36bp.
21M reads passed filtering, when aligned using bowtie, only about 10k reads mapped to the reference genome. We also found huge duplicate reads in our FASTQ file.
Does Illumina has officially quality control results to tell us whether our sequencing process is OK? Thanks a lot!

[zee]

I highly recommend you doing your own QC with a program like FASTQC or FASTX and analyzing the quality metrics in each lane.

[xquan]

We've also met this question, except that our tag size was 36bp.
21M reads passed filtering, when aligned using bowtie, only about 10k reads mapped to the reference genome. We also found huge duplicate reads in our FASTQ file.
Does Illumina has officially quality control results to tell us whether our sequencing process is OK? Thanks a lot!

The only quality control by Illumina I know is the chastity filtering process. Too lanes of our data completely failed to pass the filtering. And I didn't use any of the reads failed to pass the chastity filtering process. Does anyone know other Illumina quality control?

[xquan]

I highly recommend you doing your own QC with a program like FASTQC or FASTX and analyzing the quality metrics in each lane.

I have done QC check with FASTQC, and our reads after my QC from all lanes got good results except the k-mer analysis (which gave yellow warning sign).

[glacerda]

The Illumina mate pair libraries used to be in reverse-forward orientation ( --rf parameter ), Unless something has changed in the mate pair protocol, this could be the cause of the bad mapping.

[xquan]

The Illumina mate pair libraries used to be in reverse-forward orientation ( --rf parameter ), Unless something has changed in the mate pair protocol, this could be the cause of the bad mapping.

Do you mean that I should use --rf instead of --fr for the pair-end reads? I thought mate pair should be forward-forward orientation and use --ff.

[glacerda]

Hi xquan,

Illumina mate pair libraries are supposed contain outwards facing reads ( <-- --> ) and we should use --rf in bowtie. Illumina Mate Pair libraries are used to long insert lengths, greater than 2 Kbp usually.

Illumina paired end libraries are supposed to contain inwards facing reads ( --> <-- ) and we should use --fr in bowtie. Illumina Paired Ends are used to short insert lengths (at most 500 bp) usually.

As far as I can remeber, 454 and SOLiD use forward-forward ( --> --> )

[xquan]

Hi xquan,

Illumina mate pair libraries are supposed contain outwards facing reads ( <-- --> ) and we should use --rf in bowtie. Illumina Mate Pair libraries are used to long insert lengths, greater than 2 Kbp usually.

Illumina paired end libraries are supposed to contain inwards facing reads ( --> <-- ) and we should use --fr in bowtie. Illumina Paired Ends are used to short insert lengths (at most 500 bp) usually.

As far as I can remeber, 454 and SOLiD use forward-forward ( --> --> )

Thanks very much! I will confirm this with the sequencing company (who told me that their library preparation for mate pair is forward-forward) and try to run bowtie with --rf again.

[DZhang]

Hi,

In this case, I usually try aligning the data from one end to the reference as single-fragment to see what percentage of reads are mapped.

Douglas

https://www.contigexpress.com

[chadn737]

Have you tried Blasting some of the reads? You will sometimes be surprised by what you find when doing this.

[DZhang]

Hi chadn737,

That's a great point. Oftentimes the simplest approach is the best one. In one project, I randomly chose 10 reads and BLASTed it. They all came back mapping to an rRNA gene. No other approach is faster than BLAST to find this out.

Douglas

https://www.contigexpress.com

[stoker]

I have observed that Illumina instruments have different filters configurations. If your filters has been mounted incorrectly - in wrong positions (this is possible when you have a new device or you have a service repairs) then you may need to change bases in your reads. A to C, G to T and vice versa. We have met this problem in our lab.