Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • arrchi
    Member
    • Mar 2011
    • 46

    unique hits

    Hi there,

    I am looking for a way to find unique hits for my RNA-seq data. After searching online and in this community, I still can't find a good way to find unique hits from a sam file. Any input will be welcome.

    I used tophat to align the data to the HG19 and samtools -bq -1 to generated reliable hits.

    Here is part of the output:

    [Tophat_out]$ grep -w SRR087416.97659 accepted_hits_realiable.sam
    SRR087416.97659 0 chr1 11356 1 36M * 0 0 CAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGT BBBCBCB9CBBBC@:+>3A97AACABA9@CCCCB9# NM:i:0 NH:i:4 CC:Z:chr12 CP:i:94218
    SRR087416.97659 16 chr12 94218 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr15 CP:i:102519779
    SRR087416.97659 16 chr15 102519779 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr2 CP:i:114359624

    My questions are: Does this mean that the read SRR087416.97659 maps to chr1, chr12, and chr15?

    If I understand the concept "unique-hit" correctly, then this read can not be counted as an unique hit. Am I right?

    Thanks,

    -A
  • rnaeye
    Member
    • May 2011
    • 80

    #2
    Originally posted by arrchi View Post
    Hi there,

    I am looking for a way to find unique hits for my RNA-seq data. After searching online and in this community, I still can't find a good way to find unique hits from a sam file. Any input will be welcome.

    I used tophat to align the data to the HG19 and samtools -bq -1 to generated reliable hits.

    Here is part of the output:

    [Tophat_out]$ grep -w SRR087416.97659 accepted_hits_realiable.sam
    SRR087416.97659 0 chr1 11356 1 36M * 0 0 CAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGT BBBCBCB9CBBBC@:+>3A97AACABA9@CCCCB9# NM:i:0 NH:i:4 CC:Z:chr12 CP:i:94218
    SRR087416.97659 16 chr12 94218 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr15 CP:i:102519779
    SRR087416.97659 16 chr15 102519779 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr2 CP:i:114359624

    My questions are: Does this mean that the read SRR087416.97659 maps to chr1, chr12, and chr15?

    If I understand the concept "unique-hit" correctly, then this read can not be counted as an unique hit. Am I right?

    Thanks,

    -A
    You are correct: SRR087416.97659 sequence maps more than one location in the genome. This means that you have no way of knowing where that sequence is coming from. You need to sort your output by sequence ID, then find uniq IDs. Does this help? Unique read should hit the genome only once at one specific location.

    Comment

    • rnaeye
      Member
      • May 2011
      • 80

      #3
      btw, what instrumentation this output is coming from? Thanks.

      Comment

      • arrchi
        Member
        • Mar 2011
        • 46

        #4
        Thanks for your message.

        The result is generated by a Mac Pro with 8GB Memory and 1TB hard drive. Is that you want to know?

        Comment

        • rnaeye
          Member
          • May 2011
          • 80

          #5
          my questions was what DNA sequencing platform this output is from, such as Illumina, ABI SOLiD, etc. thanks.

          Comment

          • arrchi
            Member
            • Mar 2011
            • 46

            #6
            Oh. Sorry.

            This is Illumina RNA sequencing data.

            Comment

            • arrchi
              Member
              • Mar 2011
              • 46

              #7
              Does anybody knows that the value 0 in "SRR087416.97659 0" means? I checked samtools menu, it only says if 0x1 is unset, no assumptions can be made about .....

              Comment

              • arrchi
                Member
                • Mar 2011
                • 46

                #8
                I found an old post saying that
                Flag 0 means "the read is not paired and mapped, forward strand".
                Hope it is true.
                Last edited by arrchi; 06-01-2011, 07:55 AM.

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  Today, 05:17 AM
                • GATTACAT
                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by GATTACAT
                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                  07-01-2026, 11:43 AM
                • SEQadmin2
                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                  by SEQadmin2


                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                  Here are nine questions we think about, in roughly the order they matter, before...
                  06-18-2026, 07:11 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Today, 10:08 AM
                0 responses
                6 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, Yesterday, 11:05 AM
                0 responses
                7 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-02-2026, 11:08 AM
                0 responses
                31 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 06-30-2026, 05:37 AM
                0 responses
                28 views
                0 reactions
                Last Post SEQadmin2  
                Working...