[swbarnes2]

No, that is the correct interpretation of the flags. 8 is also the flag for "mate is unmapped", which in theory, the first read should have, since it has the 4 flag for being unmapped itself. I'd guess that the 4 flag in the second read is an error, but it's hard to explain. One weirdness that I know bwa has when aligning is it concatenates separate reference sequences, so if a read crosses over two references, it's have a mapping position, and be flagged as unmapped (PICARD yells at you when it sees this), but that wouldn't seem to explain what you have there.

And no, unmapped paired reads might not have an * in the rname. If a read is unmapped, and its mate is mapped, it's supposed to have the rname and position of its mate. That's so they will sort together. It's not a bug, it's a feature, really. The flag is supposed to show this, maybe the ISIZE field will too.

[shruti]

thank you for the reply.

In the example of my previous msg the reads have different coordinates and so essentially they are mapped. I had also tried doing a blat of the sequence on the mouse whole genome (mm9) and both of them show multiple hits.

Just for clarity, below are the best hits for both the reads. the latter read has many hits.
---------------------------------------------------------------------------------------------------
browser details read1_flag99 50 1 50 50 100.0% 9 - 115259995 115260044 50
browser details read1_flag99 50 1 50 50 100.0% 9 - 95326385 95326434 50
browser details read1_flag99 50 1 50 50 100.0% X + 166650106 166650155 50
browser details read1_flag99 50 1 50 50 100.0% 2 + 181747899 181747948 50
browser details read1_flag99 50 1 50 50 100.0% 2 + 57481930 57481979 50

browser details read2_flag151 50 1 50 50 100.0% 9 - 95326353 95326402 50
browser details read2_flag151 50 1 50 50 100.0% 6 - 50997472 50997521 50
browser details read2_flag151 50 1 50 50 100.0% 6 - 4873828 4873877 50
browser details read2_flag151 50 1 50 50 100.0% 6 - 4874144 4874193 50



Also I would expect that if a read is mapped & the mate pair is unmapped then the flag for the read could not be 99, it may be the values 75 / 91 / 139 / 155. but then I might be wrong.

Just to clarify "mate reverse strand" means that the mate pair is mapped in reverse strand?

[stonyc]

Flag = *?

Hi, I am mapping 454 reads with the default bwa bwasw, and I'm mostly getting good results, but a couple have me stumped...

I understand that the FLAG of 4, with aligned chromosomal coordinates indicates an alignment possibly spanning across multiple chromosomes.

But, I'm also getting a few alignments like this:

GVVGYHW01CSFZ8 * chrIII 7855436 199 139M * 0 0 GATCTGCCAAGCAACAGGCTAAGTCTCGCAATCAAGCCGTCAGAAAGTTCGCAGTCAAGGCTTAAGTGGCTTGTATTCATTGTTATCCATTCATGGACATTGTTCTGGTTCAATTTCAATGAAAATTGTTGCTTATGTT @BEEA<<552275<----/8//66B<<@BIIIIHHHIIIIIIIIIIIIHCDCHHEIEEEECCDBIEEEIIII???IIIIIIIIIHHHDDB131ABB@AA=EABACB?455;IIIIIIIIIIIIIIIIIIIIIIIHDDDI AS:i:139 XS:i:0 XF:i:3 XE:i:4 XN:i:0

As you can see, the FLAG for this alignment is "*"... is this similar to the FLAG=4 situation described above, or something else entirely?

Thanks...

[edge]

Hi,

Is it 16 refer to read map at reverse strand?
Can I know which bitwise flag refer to those read that map in pair?

Thanks.